Anchoa marinii

Hildebrand, 1943 · species

image placeholder — illustration coming later

Animalia/Chordata/Clupeiformes/Engraulidae/Anchoa

At a glance

Occurrence records78

Data sources8

Biological traits5

DNA specimens13

eDNA detections0

Sources8 archives

Databases and archives Anchoa marinii's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility56 records↗

OBISOcean Biodiversity Information System22 records↗

BOLD SystemsCentre for Biodiversity Genomics13 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

WikidataWikimedia Foundationstructured facts↗

Catalogue of LifeCOLtaxonomy↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources5 traits

Occurrence & distributionGBIF · OBIS78 records

DNA & barcodingBOLD13 specimens

01Narrative

Anchoa marinii is een straalvinnige vis uit de familie van ansjovissen (Engraulidae), orde haringachtigen (Clupeiformes), die voorkomt in het zuidwesten van de Atlantische Oceaan.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesFishBase

Size & morphology1

Body length14 cm

Habitat & environment2

Habitat saltwateryes

Habitat zonepelagic-oceanic

Other traits2

Depth max20 m

Vulnerability14.19

05DNA & barcoding13 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Anchoa marinii has left across the world's sequence archives.

At a glance

DNA specimens13

BINs2

Marker genes1

Countries1

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P652 bp consensus12 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 83% of positions are identical in every specimen.

Where individuals differ — all 108 variable positions, in barcode order

4Amostly conserved

7Tmostly conserved

8Cmostly conserved

10Tvariable

11Amostly conserved

13Tmostly conserved

16Cmostly conserved

34Amostly conserved

37Amostly conserved

40Amostly conserved

42Cmostly conserved

43Amostly conserved

55Cmostly conserved

59Amostly conserved

61Tmostly conserved

76Tmostly conserved

79Amostly conserved

82Amostly conserved

85Amostly conserved

97Gmostly conserved

100Cmostly conserved

106Amostly conserved

118Amostly conserved

124Tmostly conserved

127Tmostly conserved

136Amostly conserved

148Cmostly conserved

163Gmostly conserved

166Cmostly conserved

169Tmostly conserved

178Cmostly conserved

187Cmostly conserved

196Gmostly conserved

211Amostly conserved

214Gmostly conserved

217Tmostly conserved

226Gmostly conserved

232Cmostly conserved

241Gmostly conserved

247Cmostly conserved

250Gmostly conserved

262Cvariable

268Tmostly conserved

277Cmostly conserved

280Tmostly conserved

283Cmostly conserved

286Tmostly conserved

289Cmostly conserved

292Amostly conserved

298Tvariable

301Tmostly conserved

310Gvariable

313Amostly conserved

316Tmostly conserved

319Gmostly conserved

322Amostly conserved

325Gmostly conserved

334Tmostly conserved

349Amostly conserved

358Amostly conserved

364Tmostly conserved

370Amostly conserved

376Gmostly conserved

379Amostly conserved

382Tmostly conserved

383Tmostly conserved

385Amostly conserved

388Amostly conserved

391Cmostly conserved

394Cmostly conserved

400Cmostly conserved

403Cvariable

406Amostly conserved

409Amostly conserved

412Tmostly conserved

430Tmostly conserved

439Tmostly conserved

442Tmostly conserved

451Cmostly conserved

460Tmostly conserved

463Gmostly conserved

466Gmostly conserved

469Amostly conserved

475Tmostly conserved

478Tmostly conserved

487Cmostly conserved

490Amostly conserved

515Tvariable

520Cmostly conserved

523Gvariable

538Cmostly conserved

541Tmostly conserved

547Tmostly conserved

550Cmostly conserved

554Cvariable

559Tmostly conserved

565Amostly conserved

595Tmostly conserved

604Tmostly conserved

610Cmostly conserved

616Cmostly conserved

619Gmostly conserved

625Amostly conserved

628Amostly conserved

631Tmostly conserved

634Gmostly conserved

643Cmostly conserved

652Amostly conserved

CCTATATCTTATTTTCGGTGCCTGAGCAGGAATAGTAGGAACAGCACTTAGCCTCCTAATTCGAGCAGAATTAAGTCAACCAGGAGCACT …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)6.5%

Haplotypes8

BINs2

Most divergent pair14.9%

S.America

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Engraulis mordaxsame family8.3%Engraulis capensissame family8.7%Engraulis australissame family9.0%Engraulis encrasicolussame family9.1%Engraulis japonicussame family9.5%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type78 records

Wild obs. + sensor2

Museum / vouchered72

Other4

Origin

Native2

Range

Area of Occupancy AOO180 km²

Depth

0–200 m sunlit2

200–1000 m twilight0

1–4 km midnight0

>4 km abyssal0

median 8.5 m · max 12 m · 2 records with depth

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy0% within 1 km

≤10 km 1

1 georeferenced · 1 without coordinates

Open the mapobservation + sensor2

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy

no georeferenced coordinates · 72 records without

Open the institutions mapphysical evidence72

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions2 of 8 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Museu de Zoologia da Universidade de Sao Paulolocation not on record	29
FURGlocation not on record	8
USP-RPlocation not on record	4
IIMyClocation not on record	3
Paris, FR	2
Ann Arbor, US	2
FishBaselocation not on record	1
CAJlocation not on record	1

8 institutions · 50 of 72 vouchered records shown

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)