Ancala fasciata

(Fabricius, 1775) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Diptera/Tabanidae/Ancala

At a glance

Occurrence records55

Data sources5

Biological traits0

DNA specimens5

eDNA detections18

Sources5 archives

Databases and archives Ancala fasciata's data was compiled from.

GBIFGlobal Biodiversity Information Facility55 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI18 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics5 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page3 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

Occurrence & distributionGBIF55 records

Environmental DNA1 datasets · 3 countries18 detections

DNA & barcodingBOLD5 specimens

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding5 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Ancala fasciata has left across the world's sequence archives.

At a glance

DNA specimens5

BINs2

Marker genes1

eDNA detections18

Countries3

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P676 bp consensus5 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 96% of positions are identical in every specimen.

Where individuals differ — all 24 variable positions, in barcode order

33Cvariable

51Cmostly conserved

60Amostly conserved

75Tvariable

78Tvariable

162Tvariable

177Amostly conserved

180Tmostly conserved

198Cmostly conserved

280Cmostly conserved

336Tmostly conserved

357Cmostly conserved

360Tmostly conserved

363Amostly conserved

366Tmostly conserved

384Avariable

399Tmostly conserved

465Cmostly conserved

483Tvariable

501Avariable

609Cmostly conserved

615Tmostly conserved

634Cmostly conserved

651Tvariable

TATTTTATTTTTGGTGCATGAGCTGGAATAATCGGTACATCATTAAGTATCTTAATTCGAGCTGAATTAGGGCATCCTGGATCATTAATT …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)1.7%

Haplotypes3

BINs2

Most divergent pair1.2%

Africa

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Hybomitra trepidasame family6.3%Hybomitra micanssame family6.3%Hybomitra tropicasame family6.6%Hybomitra fulvilateralissame family6.6%Hybomitra solstitialissame family6.8%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type55 records

Wild obs. + sensor5

Museum / vouchered50

Range

Area of Occupancy AOO96 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy50% within 1 km

≤100 m 2≤10 km 2

4 georeferenced · 1 without coordinates

Open the mapobservation + sensor5

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy3% within 1 km

≤1 km 1≤10 km 33

34 georeferenced · 16 without coordinates

Open the institutions mapphysical evidence50

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions1 of 5 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Instituto de Investigação Científica Tropicallocation not on record	31
KwaZulu-Natal Museumlocation not on record	6
National Museums of Kenyalocation not on record	5
UNHClocation not on record	3
Cape Town, ZA	1

5 institutions · 46 of 50 vouchered records shown · 4 without an institution code

09Environmental DNA18 detections

Where the DNA of Ancala fasciata was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found18

Studies independent surveys1

Countries3

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 18 detections have coordinates

Open the map3 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median21.8 °C 21.8–26.0

Seasonal swing summer↔winter1.70 °C

Max temp (day)23.2 °C 23.2–28.5

Min temp (night)19.9 °C 19.9–23.7

Precipitation68.7 mm/mo 68.7–256

Air humidity61.7 % 61.7–69.4

Moisture balance-52.5 mm/mo -52.5–118

Vapour deficit998 Pa 998–1,025

Wind speed1.70 m/s 1.00–1.70

Cloud cover39.6 % 39.6–42.9

CHELSA 1981–2010, ~9 km grid, at location & month of 17 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)