Ancala africana

(Gray, 1832) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Diptera/Tabanidae/Ancala

At a glance

Occurrence records125

Data sources5

Biological traits0

DNA specimens8

eDNA detections8

Sources5 archives

Databases and archives Ancala africana's data was compiled from.

GBIFGlobal Biodiversity Information Facility125 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI8 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics8 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page3 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

Occurrence & distributionGBIF125 records

Environmental DNA1 datasets · 1 countries8 detections

DNA & barcodingBOLD8 specimens

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding8 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Ancala africana has left across the world's sequence archives.

At a glance

DNA specimens8

BINs1

Marker genes1

eDNA detections8

Countries1

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus8 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 99% of positions are identical in every specimen.

Where individuals differ — all 9 variable positions, in barcode order

40Tmostly conserved

88Gmostly conserved

220Tmostly conserved

263Cmostly conserved

301Tmostly conserved

316Avariable

343Cmostly conserved

634Cmostly conserved

658Tmostly conserved

AACATTATATTTTATTTTTGGAGCATGAGCTGGAATAATTGGTACATCATTAAGTATCTTAATTCGAGCAGAATTAGGCCACCCAGGGTC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.41%

Haplotypes5

BIN1

Most divergent pair0.91%

AfricaOther

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Ancala fasciatasame genus6.8%Hybomitra rhombicasame family6.8%Tabanus systenussame family7.1%Hybomitra solstitialissame family7.1%Tabanus fraternussame family7.2%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type125 records

Wild obs. + sensor47

Museum / vouchered78

Range

Area of Occupancy AOO344 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy87% within 1 km

≤100 m 23≤1 km 4≤10 km 2>10 km 2

31 georeferenced · 16 without coordinates

Open the mapobservation + sensor47

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy0% within 1 km

≤10 km 6

6 georeferenced · 72 without coordinates

Open the institutions mapphysical evidence78

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions2 of 7 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
National Museums of Kenyalocation not on record	25
KwaZulu-Natal Museumlocation not on record	22
Cape Town, ZA	5
UNHClocation not on record	4
Durban Natural Science Museumlocation not on record	2
East Lansing, US	2
Instituto de Investigação Científica Tropicallocation not on record	1

7 institutions · 61 of 78 vouchered records shown · 17 without an institution code

09Environmental DNA8 detections

Where the DNA of Ancala africana was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found8

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 8 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median26.9 °C 26.3–27.1

Seasonal swing summer↔winter5.90 °C

Max temp (day)30.2 °C 28.0–31.0

Min temp (night)24.1 °C 22.5–25.8

Precipitation217 mm/mo 191–299

Air humidity64.9 % 62.9–66.7

Moisture balance138 mm/mo

Vapour deficit1,251 Pa 1,138–1,329

Wind speed2.60 m/s

Cloud cover47.0 % 44.2–59.7

CHELSA 1981–2010, ~9 km grid, at location & month of 7 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)