Anatis mali

(Say, 1824) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Coleoptera/Coccinellidae/Anatis

At a glance

Occurrence records3 668

Data sources9

Biological traits0

DNA specimens23

eDNA detections5

Sources9 archives

Databases and archives Anatis mali's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility3 668 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI5 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics23 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GoaTGenomes on a Tree · Sangergenome & karyotype↗

Tree of SexTree of Sex Consortiumgenome & karyotype↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF3 668 records

Environmental DNA1 datasets · 1 countries5 detections

DNA & barcodingBOLD23 specimens

Genome at a glanceGoaT · TreeOfSex2n = 18

01Narrative

Anatis mali, the eye-spotted lady beetle, is a species of lady beetle in the family Coccinellidae. It is found in North America.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding23 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Anatis mali has left across the world's sequence archives.

At a glance

DNA specimens23

BINs1

Marker genes1

eDNA detections5

Countries2

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus15 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 97% of positions are identical in every specimen.

Diversity (π)0.54%

Haplotypes2

BIN1

Most divergent pair0.30%

Where individuals differ — all 23 variable positions, in barcode order

184Tmostly conserved

499Tmostly conserved

532Tmostly conserved

536Tmostly conserved

538Amostly conserved

539Cmostly conserved

541Tmostly conserved

543Tmostly conserved

544Amostly conserved

545Tmostly conserved

546Cmostly conserved

547Tmostly conserved

549Tmostly conserved

550Amostly conserved

551Cmostly conserved

552Cmostly conserved

553Tmostly conserved

554Gmostly conserved

557Tmostly conserved

558Tmostly conserved

561Cmostly conserved

565Amostly conserved

655Amostly conserved

AACGTTATACTTTTTATTTGGGATATGGGCTGGAATAGTAGGAACTTCATTAAGAATTCTTATTCGATTAGAATTAGGAACTACTAATAG …

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Anatis ocellatasame genus2.6%Anatis labiculatasame genus9.6%Micraspis discolorsame family11.7%Halyzia sedecimguttatasame family12.3%Halyzia sanscritasame family12.5%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

06Genome at a glanceGoaT · TreeOfSex

The complete instruction manual Anatis mali carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 18 n = 9

Chromosome records18–182n range18median18mode4records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 184×GoaT · Animal Chromosome Counts Database · GoaT · Tree of Sex Database · TreeOfSex · invert

GoaT · Animal Chromosome Counts Database — ↗

GoaT · Tree of Sex Database — ↗

TreeOfSex · invert — Smith SG, Virkki N (1978) Animal Cytogenetics Vol. 3 Insecta 5 Coleoptera. Berlin: Gebruder Borntraeger. ↗

08Occurrence & distribution

Record type3 668 records

Wild obs. + sensor2 765

Museum / vouchered903

Origin

Native10

Range

Area of Occupancy AOO9 744 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy83% within 1 km

≤100 m 1 612≤1 km 337≤10 km 145>10 km 254

2 348 georeferenced · 417 without coordinates

Open the mapobservation + sensor2 765

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy75% within 1 km

≤100 m 298≤1 km 144≤10 km 128>10 km 22

592 georeferenced · 311 without coordinates

Open the institutions mapphysical evidence903

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions9 of 27 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Edmonton, CA	268
Toronto, CA	168
Royal Saskatchewan Museumlocation not on record	56
WIlocation not on record	48
Chicago, US	46
University of Alberta Museums (UAM)location not on record	46
Zadock Thompson Natural History Collection, University of Vermontlocation not on record	45
Espace pour la vielocation not on record	36
Cornell University Insect Collectionlocation not on record	30
OSUClocation not on record	29
Fairbanks Museum and Planetariumlocation not on record	22
Saint John, CA	18
Vancouver, CA	17
SOVTlocation not on record	14
VTFPRlocation not on record	13
Wuzhou, CN	5
University of Guelph, Centre for Biodiversity Genomicslocation not on record	5
University of Guelphlocation not on record	5
Lexington, US	4
Decorah, US	2
Universidad Católica de Manizaleslocation not on record	1
University of Vermontlocation not on record	1
MIDDlocation not on record	1
East Lansing, US	1
Royal British Columbia Museumlocation not on record	1
University of Alaska Museumlocation not on record	1
Museo civico La Terra e l'Uomo di Crocetta del Montellolocation not on record	1

27 institutions · 884 of 903 vouchered records shown · 19 without an institution code

09Environmental DNA5 detections

Where the DNA of Anatis mali was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found5

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 5 detections have coordinates

Open the map1 country0

Betula forest, under logs

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median17.4 °C 17.4–17.4

Seasonal swing summer↔winter37.0 °C

Max temp (day)21.9 °C

Min temp (night)13.2 °C

Precipitation113 mm/mo

Air humidity56.0 %

Moisture balance-1.40 mm/mo

Vapour deficit877 Pa

Wind speed1.70 m/s

Cloud cover60.1 %

CHELSA 1981–2010, ~9 km grid, at location & month of 1 detection point · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Anatis mali

At a glance

Sources9 archives

At a glance

Chromosomes & ploidyhow the DNA is packaged

Record type3 668 records

Origin

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions9 of 27 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type3 668 records