Anatis labiculata

(Say, 1824) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Coleoptera/Coccinellidae/Anatis

At a glance

Occurrence records2 714

Data sources8

Biological traits0

DNA specimens17

eDNA detections13

Sources8 archives

Databases and archives Anatis labiculata's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility2 714 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI13 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics17 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GoaTGenomes on a Tree · Sangergenome ~0.66 Gbp↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF2 714 records

Environmental DNA1 datasets · 2 countries13 detections

DNA & barcodingBOLD17 specimens

Genome at a glanceGoaT655 Mbp

01Narrative

Anatis labiculata, known generally as the fifteen-spotted lady beetle or fifteen-spotted ladybird beetle, is a species of lady beetle in the family Coccinellidae. It is found in North America. Fifteen-spotted lady beetle, Anatis labiculata Fifteen-spotted lady beetle, Anatis labiculata

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding17 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Anatis labiculata has left across the world's sequence archives.

At a glance

DNA specimens17

BINs2

Marker genes1

eDNA detections13

Countries2

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus16 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 96% of positions are identical in every specimen.

Where individuals differ — all 29 variable positions, in barcode order

19Cmostly conserved

40Gmostly conserved

45Tmostly conserved

241Gmostly conserved

262Gmostly conserved

271Cmostly conserved

289Amostly conserved

292Tmostly conserved

316Gmostly conserved

325Amostly conserved

331Gmostly conserved

337Tmostly conserved

340Tvariable

343Cmostly conserved

347Cmostly conserved

373Tmostly conserved

375Cvariable

401Cvariable

421Cmostly conserved

433Tmostly conserved

438Tmostly conserved

496Cmostly conserved

529Tmostly conserved

531Tmostly conserved

538Amostly conserved

565Gmostly conserved

589Cvariable

628Avariable

631Amostly conserved

GACATTATACTTTCTATTCGGTATATGGGCTGGGATAGTGGGAATATCACTAAGAATTATTATTCGATTAGAATTAGGAACTACTAATAG …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)1.6%

Haplotypes5

BINs2

Most divergent pair4.1%

N.America

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Anatis ocellatasame genus9.1%Anatis malisame genus9.6%Halyzia sedecimguttatasame family10.5%Coelophora bissellatasame family11.5%Halyzia ischischerinisame family12.6%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

06Genome at a glanceGoaT

The complete instruction manual Anatis labiculata carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Genome sizehow big the whole instruction manual is

Genome size655 260 000 bp

Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).

BACTERIUM Carsonella ruddii0.00016 Gb

FUNGUS0.04 Gb

INSECT0.25 Gb

THIS GENOME Anatis labiculata0.66 Gb

HUMAN3.2 Gb

WHEAT17 Gb

FERN Tmesipteris160.45 Gb

08Occurrence & distribution

Record type2 714 records

Wild obs. + sensor1 817

Museum / vouchered897

Origin

Native9

Range

Area of Occupancy AOO7 356 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy83% within 1 km

≤100 m 1 004≤1 km 265≤10 km 115>10 km 138

1 522 georeferenced · 295 without coordinates

Open the mapobservation + sensor1 817

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy16% within 1 km

≤100 m 7≤1 km 54≤10 km 252>10 km 70

383 georeferenced · 514 without coordinates

Open the institutions mapphysical evidence897

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions10 of 29 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Chicago, US	290
University Park, US	115
Lexington, US	100
OSUClocation not on record	59
WIlocation not on record	52
Zadock Thompson Natural History Collection, University of Vermontlocation not on record	52
Fairbanks Museum and Planetariumlocation not on record	35
CUlocation not on record	32
University of Guelphlocation not on record	22
University of Alberta Museums (UAM)location not on record	16
Cornell University Insect Collectionlocation not on record	16
Wuzhou, CN	14
Champaign, US	14
Espace pour la vielocation not on record	11
Natural History Museum of Utahlocation not on record	8
UDlocation not on record	8
Royal Saskatchewan Museumlocation not on record	7
Universidad Católica de Manizaleslocation not on record	6
MIDDlocation not on record	4
UFPRlocation not on record	4
University of Guelph, Centre for Biodiversity Genomicslocation not on record	4
Vancouver, CA	2
Decorah, US	2
VTFPRlocation not on record	2
SOVTlocation not on record	2
Chicago, US	1
Cambridge, US	1
Saint John, CA	1
University of Vermontlocation not on record	1

29 institutions · 881 of 897 vouchered records shown · 16 without an institution code

09Environmental DNA13 detections

Where the DNA of Anatis labiculata was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found13

Studies independent surveys1

Countries2

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 13 detections have coordinates

Open the map2 countries0

Forest

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median17.1 °C 15.6–20.0

Seasonal swing summer↔winter29.2 °C

Max temp (day)22.4 °C 21.6–25.5

Min temp (night)12.9 °C 11.9–15.2

Precipitation85.6 mm/mo 77.8–92.0

Air humidity57.8 % 57.6–59.1

Moisture balance-57.7 mm/mo -67.9–-41.7

Vapour deficit820 Pa 728–977

Wind speed3.70 m/s 2.30–4.40

Cloud cover42.8 % 39.0–43.5

CHELSA 1981–2010, ~9 km grid, at location & month of 11 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Anatis labiculata

At a glance

Sources8 archives

At a glance

Genome sizehow big the whole instruction manual is

Record type2 714 records

Origin

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions10 of 29 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type2 714 records