Anathix puta

Grote & Robinson, 1868 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Noctuidae/Anathix

At a glance

Occurrence records974

Data sources7

Biological traits0

DNA specimens41

eDNA detections44

Sources7 archives

Databases and archives Anathix puta's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility974 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI44 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics41 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF974 records

Environmental DNA1 datasets · 2 countries44 detections

DNA & barcodingBOLD41 specimens

01Narrative

Anathix puta, known generally as the puta sallow moth or poplar catkin moth, is a species of cutworm or dart moth in the family Noctuidae. It is found in North America. The MONA or Hodges number for Anathix puta is 9962.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding41 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Anathix puta has left across the world's sequence archives.

At a glance

DNA specimens41

BINs1

Marker genes1

eDNA detections44

Countries2

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus41 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 99% of positions are identical in every specimen.

Where individuals differ — all 5 variable positions, in barcode order

1Amostly conserved

2Amostly conserved

3Cmostly conserved

542Cmostly conserved

646Cmostly conserved

AACATTATATTTTATTTTTGGAATTTGAGCAGGAATAGTCGGTACATCTTTAAGACTATTAATTCGTGCTGAATTAGGAAATCCTGGATC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.99%

Haplotypes8

BIN1

Most divergent pair0.61%

N.America

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Anathix aggressasame genus2.6%Anathix rallasame genus3.5%Eremohadena immundasame family5.4%Conistra ligulasame family5.5%Xylena formosasame family5.8%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type974 records

Wild obs. + sensor411

Museum / vouchered563

Range

Area of Occupancy AOO1 452 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy94% within 1 km

≤100 m 291≤1 km 57≤10 km 9>10 km 13

370 georeferenced · 41 without coordinates

Open the mapobservation + sensor411

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy45% within 1 km

≤100 m 39≤1 km 58≤10 km 110>10 km 9

216 georeferenced · 347 without coordinates

Open the institutions mapphysical evidence563

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions8 of 18 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
University of Alberta Museums (UAM)location not on record	193
East Lansing, US	68
Cornell University Insect Collectionlocation not on record	53
Royal Saskatchewan Museumlocation not on record	47
New Haven, US	36
St. Paul, US	35
Edmonton, CA	19
Vernal, US	15
Cambridge, US	14
Denver, US	14
University of Guelph, Centre for Biodiversity Genomicslocation not on record	12
Colorado State Universitylocation not on record	10
Oregon State Arthropod Collectionlocation not on record	9
Toronto, CA	4
Cleveland Museum of Natural History, OH (CLEV)location not on record	3
University of Guelphlocation not on record	1
KWPlocation not on record	1
University of Alaska Museumlocation not on record	1

18 institutions · 535 of 563 vouchered records shown · 28 without an institution code

09Environmental DNA44 detections

Where the DNA of Anathix puta was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found44

Studies independent surveys1

Countries2

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 44 detections have coordinates

Open the map2 countries0

1. Forest & Woodland1. Forest & Woodland|1.1. Boreal ForestForestMixed Habitat5. Wetlands (inland)|5.4. Bogs, Marshes, Swa…Temperate mixed forest

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median15.9 °C 13.8–17.5

Seasonal swing summer↔winter30.0 °C

Max temp (day)21.8 °C 18.6–24.2

Min temp (night)11.4 °C 9.50–13.5

Precipitation66.3 mm/mo 24.7–107

Air humidity57.3 % 50.2–61.0

Moisture balance-40.9 mm/mo -84.0–14.0

Vapour deficit761 Pa 669–946

Wind speed2.40 m/s 1.30–3.20

Cloud cover43.4 % 31.4–64.2

CHELSA 1981–2010, ~9 km grid, at location & month of 43 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)