Anathix aggressa

Smith, 1907 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Noctuidae/Anathix

At a glance

Occurrence records118

Data sources7

Biological traits0

DNA specimens11

eDNA detections11

Sources7 archives

Databases and archives Anathix aggressa's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility118 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI11 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics11 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF118 records

Environmental DNA1 datasets · 2 countries11 detections

DNA & barcodingBOLD11 specimens

01Narrative

Anathix aggressa is a species of cutworm or dart moth in the family Noctuidae. It is found in North America. The MONA or Hodges number for Anathix aggressa is 9963.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding11 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Anathix aggressa has left across the world's sequence archives.

At a glance

DNA specimens11

BINs3

Marker genes1

eDNA detections11

Countries2

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus11 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 96% of positions are identical in every specimen.

Where individuals differ — all 26 variable positions, in barcode order

13Tmostly conserved

31Amostly conserved

40Cmostly conserved

43Tmostly conserved

49Cvariable

67Avariable

100Amostly conserved

136Tmostly conserved

160Avariable

166Amostly conserved

172Tmostly conserved

262Avariable

292Tmostly conserved

304Cvariable

401Cmostly conserved

412Tmostly conserved

457Cmostly conserved

514Tmostly conserved

520Gvariable

529Amostly conserved

556Tmostly conserved

565Tmostly conserved

577Gmostly conserved

616Cvariable

628Avariable

646Cmostly conserved

AACACTATATTTTATTTTCGGAATTTGAGCAGGAATAGTCGGTACATCCTTAAGACTATTAATTCGAGCTGAATTAGGAAACCCTGGATC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)1.3%

Haplotypes7

BINs3

Most divergent pair2.4%

N.America

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Anathix putasame genus2.6%Anathix rallasame genus3.5%Conistra ligulasame family6.1%Conistra ragusaesame family6.2%Conistra aliciasame family6.2%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type118 records

Wild obs. + sensor34

Museum / vouchered84

Range

Area of Occupancy AOO208 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy68% within 1 km

≤100 m 5≤1 km 12≤10 km 4>10 km 4

25 georeferenced · 9 without coordinates

Open the mapobservation + sensor34

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy82% within 1 km

≤100 m 9≤1 km 5≤10 km 1>10 km 2

17 georeferenced · 67 without coordinates

Open the institutions mapphysical evidence84

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions7 of 11 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
University of Alberta Museums (UAM)location not on record	45
Colorado State Universitylocation not on record	10
St. Paul, US	6
East Lansing, US	5
Mississippi State, US	4
Oregon State Arthropod Collectionlocation not on record	4
Royal Saskatchewan Museumlocation not on record	2
Philadelphia, US	1
New Haven, US	1
Denver, US	1
Toronto, CA	1

11 institutions · 80 of 84 vouchered records shown · 4 without an institution code

09Environmental DNA11 detections

Where the DNA of Anathix aggressa was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found11

Studies independent surveys1

Countries2

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 11 detections have coordinates

Open the map2 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median16.5 °C 14.4–18.5

Seasonal swing summer↔winter26.2 °C

Max temp (day)22.9 °C 20.9–25.9

Min temp (night)11.0 °C 8.10–13.1

Precipitation32.9 mm/mo 14.8–86.5

Air humidity49.2 % 45.9–58.8

Moisture balance-86.3 mm/mo -108–-13.6

Vapour deficit988 Pa 825–1,025

Wind speed3.70 m/s 1.90–4.30

Cloud cover32.0 % 21.0–47.0

CHELSA 1981–2010, ~9 km grid, at location & month of 11 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)