Anastrepha leptozona

Hendel, 1914 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Diptera/Tephritidae/Anastrepha

At a glance

Occurrence records74

Data sources8

Biological traits0

DNA specimens56

eDNA detections55

Sources8 archives

Databases and archives Anastrepha leptozona's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility74 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI55 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics56 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GoaTGenomes on a Tree · Sangergenome & karyotype↗

Tree of SexTree of Sex Consortiumgenome & karyotype↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF74 records

Environmental DNA1 datasets · 6 countries55 detections

DNA & barcodingBOLD56 specimens

Genome at a glanceGoaT · TreeOfSex2n = 10

01Narrative

Anastrepha leptozona adalah spesies lalat yang tergolong famili Tephritidae. Spesies ini juga merupakan bagian dari ordo Diptera, kelas Insecta, filum Arthropoda, dan kingdom Animalia. Kebanyakan anggota spesies ini bertelur dalam jaringan tumbuhan, tempat larva menemukan makanan pertamanya setelah lahir. Lalat dewasa biasanya berumur sangat pendek. Beberapa hidup selama kurang dari seminggu.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding56 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Anastrepha leptozona has left across the world's sequence archives.

At a glance

DNA specimens56

BINs2

Marker genes2

eDNA detections55

Countries7

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus48 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 95% of positions are identical in every specimen.

Where individuals differ — all 34 variable positions, in barcode order

34Tmostly conserved

43Tmostly conserved

79Amostly conserved

82Cmostly conserved

91Cmostly conserved

127Amostly conserved

154Cmostly conserved

166Amostly conserved

199Amostly conserved

211Amostly conserved

212Tmostly conserved

220Tmostly conserved

223Tmostly conserved

226Cmostly conserved

263Cmostly conserved

268Amostly conserved

277Tmostly conserved

361Cmostly conserved

400Amostly conserved

407Tmostly conserved

412Amostly conserved

457Cmostly conserved

463Tmostly conserved

496Amostly conserved

541Gmostly conserved

556Tmostly conserved

581Tmostly conserved

595Cmostly conserved

613Tmostly conserved

622Cmostly conserved

628Amostly conserved

634Tmostly conserved

643Amostly conserved

646Tmostly conserved

AACATTATATTTTATCTTTGGAGCATGAGCTGGTATAGTAGGTACATCTCTTAGAATTTTAATTCGAACTGAACTAGGACACCCAGGAGC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.94%

Haplotypes16

BINs2

Most divergent pair4.7%

S.AmericaN.America

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Anastrepha curvivenissame genus6.4%Anastrepha barnesisame genus7.3%Anastrepha crebrasame genus9.0%Anastrepha hadracanthasame genus9.1%Anastrepha obliquasame genus9.5%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-3P★COI-5P

animal barcode

06Genome at a glanceGoaT · TreeOfSex

The complete instruction manual Anastrepha leptozona carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 10 n = 5

Chromosome records10–102n range10median10mode4records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 104×GoaT · Animal Chromosome Counts Database · GoaT · Tree of Sex Database · TreeOfSex · invert

GoaT · Animal Chromosome Counts Database — ↗

GoaT · Tree of Sex Database — ↗

TreeOfSex · invert — Selivon, D., A. L. Perondini and L. S. Rocha (2005). "Karyotype Characterization of Anastrepha Fruit Flies (Diptera: Tephritidae)." Neotropical Entomology 34(2): 273-279. ↗

08Occurrence & distribution

Record type74 records

Wild obs. + sensor4

Museum / vouchered70

Range

Area of Occupancy AOO140 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy25% within 1 km

≤100 m 1>10 km 3

4 georeferenced

Open the mapobservation + sensor4

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy13% within 1 km

≤1 km 2≤10 km 14

16 georeferenced · 54 without coordinates

Open the institutions mapphysical evidence70

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions1 of 3 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
The University of the West Indies, Trinidad and Tobagolocation not on record	16
South Kensington, GB	5
National Biodiversity Institute, Costa Ricalocation not on record	5

3 institutions · 26 of 70 vouchered records shown · 40 without an institution code

09Environmental DNA55 detections

Where the DNA of Anastrepha leptozona was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found55

Studies independent surveys1

Countries6

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 55 detections have coordinates

Open the map6 countries0

-11.150831. Forest & Woodland|1.6. Subtropical/Tropic…

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median24.6 °C 20.6–25.8

Seasonal swing summer↔winter1.30 °C

Max temp (day)26.2 °C 22.5–29.4

Min temp (night)21.0 °C 17.9–23.5

Precipitation172 mm/mo 132–333

Air humidity69.5 % 63.2–75.8

Moisture balance51.0 mm/mo 2.00–232

Vapour deficit958 Pa 584–1,012

Wind speed1.10 m/s 0.7–1.80

Cloud cover46.5 % 20.4–58.4

CHELSA 1981–2010, ~9 km grid, at location & month of 45 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)