Anastrepha obliqua

(Macquart, 1835) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Diptera/Tephritidae/Anastrepha

At a glance

Occurrence records649

Data sources10

Biological traits2

DNA specimens842

eDNA detections491

Sources10 archives

Databases and archives Anastrepha obliqua's data was compiled from.

WikipediaWikimedia Foundation4 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility649 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI491 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics842 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GoaTGenomes on a Tree · Sangergenome & karyotype↗

NCBIUS National Library of Medicinegenome & karyotype↗

Tree of SexTree of Sex Consortiumgenome & karyotype↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources2 traits

Occurrence & distributionGBIF649 records

Environmental DNA1 datasets · 6 countries491 detections

DNA & barcodingBOLD842 specimens

Genome at a glanceGoaT · TreeOfSex · NCBI≈837 Mbp

01Narrative

Anastrepha obliqua is a species of fruit fly. It is the most important fruit fly pest of mangoes in Neotropics and attacks a wide range of other spicy fruits. A. obliqua is widespread in Mexico, Central and South America and the West Indies. It is sometimes called the West Indian fruit fly in English.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesPantheon

Diet & foraging2

Feeding guild (adult)nectivore

Feeding guild (larval)herbivore

05DNA & barcoding842 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Anastrepha obliqua has left across the world's sequence archives.

At a glance

DNA specimens842

BINs1

Marker genes7

eDNA detections491

Countries18

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P621 bp consensus352 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 98% of positions are identical in every specimen.

Where individuals differ — all 12 variable positions, in barcode order

99Tmostly conserved

162Avariable

168Tvariable

189Avariable

252Tvariable

337Tvariable

435Avariable

471Tvariable

513Amostly conserved

528Tmostly conserved

576Cmostly conserved

597Tmostly conserved

GGAGCATGAGCTGGAATAGTAGGAACATCTCTTAGAATTCTAATTCGAACTGAATTAGGACATCCAGGAGCCTTAATTGGAGATGATCAA …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens. Showing the 28 commonest of 51 variants.

Diversity (π)1.2%

Haplotypes51

BIN1

Most divergent pair3.4%

S.AmericaN.AmericaOther

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Eligma narcissussame order17.0%Paracrama dulcissimasame order17.3%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-3P★COI-5P★ITS★ITS218S-3P18S-5PCYTB

animal barcodefungal barcoderibosomalmitochondrial

Organelle genome

Besides the big genome in the nucleus, cells carry a small, circular loop of DNA inside the cell's energy factories — the mitochondria. It is inherited almost only from the mother and is a leftover from ancient bacteria that moved into the cell. The mitochondrial markers above (ND*, COX, CYTB…) are read from exactly this loop. Outer ring = one strand, inner ring = the other.

▸ Tap any coloured segment — or a gene chip — to see what it is

Mitochondrion

NC_071715 ↗ · 13 protein · 22 tRNA · 2 rRNA

ND2COX1COX2ATP8ATP6COX3ND3ND5ND4ND4LND6CYTBND1rrn16rrn12

◖ violet arc = the COI-5P barcode — the ~650 bp read used to ID this species

Pick a coloured segment on the ring — or a gene chip — to read what that gene does.

protein-codingrRNAtRNA

06Genome at a glanceGoaT · TreeOfSex · NCBI

The complete instruction manual Anastrepha obliqua carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Genome sizehow big the whole instruction manual is

Genome size≈836 742 189 bp assembly estimate

Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).

BACTERIUM Carsonella ruddii0.00016 Gb

FUNGUS0.04 Gb

INSECT0.25 Gb

THIS GENOME Anastrepha obliqua0.84 Gb

HUMAN3.2 Gb

WHEAT17 Gb

FERN Tmesipteris160.45 Gb

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 12 n = 6

Chromosome records12–122n range12median12mode8records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 128×GoaT · Animal Chromosome Counts Database · GoaT · Tree of Sex Database · TreeOfSex · invert

GoaT · Animal Chromosome Counts Database — ↗

GoaT · Tree of Sex Database — ↗

TreeOfSex · invert — Jan, K. (1967). Cytotaxonomical Studies of Some Schizophorous Diptera. Master of Science, McGill University. ↗

TreeOfSex · invert — Selivon, D., A. L. Perondini and L. S. Rocha (2005). "Karyotype Characterization of Anastrepha Fruit Flies (Diptera: Tephritidae)." Neotropical Entomology 34(2): 273-279. ↗

Sequencing statusassembly quality — how far to trust these numbers

Assembly level tells you how finished the sequence is — from fragmented contigs, through scaffolds, up to a full chromosome-level assembly. BUSCO % estimates completeness: the share of genes expected to be present that were actually found. These describe the data quality, not the organism.

Assembly levelChromosome

08Occurrence & distribution

Record type649 records

Wild obs. + sensor340

Museum / vouchered309

Range

Area of Occupancy AOO556 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy44% within 1 km

≤100 m 1≤1 km 3>10 km 5

9 georeferenced · 331 without coordinates

Open the mapobservation + sensor340

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy100% within 1 km

≤100 m 1

1 georeferenced · 308 without coordinates

Open the institutions mapphysical evidence309

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions2 of 11 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
South Kensington, GB	88
National Biodiversity Institute, Costa Ricalocation not on record	25
Museo Entomologico de Leonlocation not on record	7
Washington, US	7
Florida State Collection of Arthropods, The Museum of Entomologylocation not on record	5
UFPRlocation not on record	4
Museum für Naturkunde Magdeburglocation not on record	4
SENASAGlocation not on record	1
FSCA, USNMlocation not on record	1
Smithsonian Tropical Research Institutelocation not on record	1
PUC-RSlocation not on record	1

11 institutions · 144 of 309 vouchered records shown · 135 without an institution code

09Environmental DNA491 detections

Where the DNA of Anastrepha obliqua was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found491

Studies independent surveys1

Countries6

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 491 detections have coordinates

Open the map6 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median25.6 °C 12.5–25.6

Seasonal swing summer↔winter3.40 °C

Max temp (day)30.0 °C 18.4–30.2

Min temp (night)21.6 °C 8.20–21.6

Precipitation150 mm/mo 79.6–164

Air humidity65.2 % 57.3–65.2

Moisture balance-0.9 mm/mo -38.4–32.9

Vapour deficit1,146 Pa 733–1,154

Wind speed1.40 m/s 1.10–5.80

Cloud cover28.8 % 28.8–45.9

CHELSA 1981–2010, ~9 km grid, at location & month of 31 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)