Anastrepha grandis

(Macquart, 1846) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Diptera/Tephritidae/Anastrepha

At a glance

Occurrence records110

Data sources10

Biological traits0

DNA specimens36

eDNA detections37

Sources10 archives

Databases and archives Anastrepha grandis's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility110 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI37 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics36 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GoaTGenomes on a Tree · Sangergenome & karyotype↗

NCBIUS National Library of Medicinegenome & karyotype↗

Tree of SexTree of Sex Consortiumgenome & karyotype↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF110 records

Environmental DNA1 datasets · 4 countries37 detections

DNA & barcodingBOLD36 specimens

Genome at a glanceGoaT · TreeOfSex · NCBI≈835 Mbp

01Narrative

Anastrepha grandis is a fruit fly, also known as the South American cucurbit fruit fly. It is a pest of various cultivated species of Cucurbitaceae, especially the pumpkin, squash and melon. Anastrepha grandis is found in almost all South American countries.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding36 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Anastrepha grandis has left across the world's sequence archives.

At a glance

DNA specimens36

BINs1

Marker genes2

eDNA detections37

Countries5

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P644 bp consensus33 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 94% of positions are identical in every specimen.

Where individuals differ — all 41 variable positions, in barcode order

42Amostly conserved

44Tmostly conserved

45Cmostly conserved

47Amostly conserved

48Amostly conserved

49Tmostly conserved

50Tmostly conserved

51Cmostly conserved

52Gmostly conserved

53Amostly conserved

54Amostly conserved

55Cmostly conserved

56Cmostly conserved

57Gmostly conserved

58Amostly conserved

60Tmostly conserved

61Tmostly conserved

63Gmostly conserved

64Gmostly conserved

65Amostly conserved

67Amostly conserved

68Tmostly conserved

69Cmostly conserved

70Cmostly conserved

73Gmostly conserved

74Amostly conserved

75Gmostly conserved

76Cmostly conserved

77Cmostly conserved

78Tmostly conserved

80Amostly conserved

81Amostly conserved

82Tmostly conserved

85Gmostly conserved

92Cmostly conserved

134Gvariable

146Amostly conserved

302Avariable

338Cvariable

392Cmostly conserved

449Cmostly conserved

TCTTCGGAGCATGAGCCGGTATAGTAGGAACATCCCTTAGAATTCTAATTCGAACCGAATTAGGACATCCAGGAGCCTTAATTGGTGATG …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)1.2%

Haplotypes3

BIN1

Most divergent pair0.93%

S.America

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Anastrepha spatulatasame genus7.8%Anastrepha interruptasame genus8.2%Anastrepha obliquasame genus8.4%Anastrepha ludenssame genus8.4%Anastrepha amitasame genus8.6%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P18S-5P

animal barcoderibosomal

06Genome at a glanceGoaT · TreeOfSex · NCBI

The complete instruction manual Anastrepha grandis carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Genome sizehow big the whole instruction manual is

Genome size≈835 097 119 bp assembly estimate

Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).

BACTERIUM Carsonella ruddii0.00016 Gb

FUNGUS0.04 Gb

INSECT0.25 Gb

THIS GENOME Anastrepha grandis0.84 Gb

HUMAN3.2 Gb

WHEAT17 Gb

FERN Tmesipteris160.45 Gb

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 12 n = 6

Chromosome records12–122n range12median12mode4records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 124×GoaT · Animal Chromosome Counts Database · GoaT · Tree of Sex Database · TreeOfSex · invert

GoaT · Animal Chromosome Counts Database — ↗

GoaT · Tree of Sex Database — ↗

TreeOfSex · invert — Selivon, D., A. L. Perondini and L. S. Rocha (2005). "Karyotype Characterization of Anastrepha Fruit Flies (Diptera: Tephritidae)." Neotropical Entomology 34(2): 273-279. ↗

Sequencing statusassembly quality — how far to trust these numbers

Assembly level tells you how finished the sequence is — from fragmented contigs, through scaffolds, up to a full chromosome-level assembly. BUSCO % estimates completeness: the share of genes expected to be present that were actually found. These describe the data quality, not the organism.

Assembly levelScaffold

08Occurrence & distribution

Record type110 records

Wild obs. + sensor7

Museum / vouchered103

Range

Area of Occupancy AOO108 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy100% within 1 km

≤100 m 5≤1 km 2

7 georeferenced

Open the mapobservation + sensor7

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy

no georeferenced coordinates · 103 records without

Open the institutions mapphysical evidence103

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions2 of 4 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
PUC-RSlocation not on record	56
South Kensington, GB	35
SENASAGlocation not on record	1
Washington, US	1

4 institutions · 93 of 103 vouchered records shown · 10 without an institution code

09Environmental DNA37 detections

Where the DNA of Anastrepha grandis was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found37

Studies independent surveys1

Countries4

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 37 detections have coordinates

Open the map4 countries0

Bosque Seco Tropical

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median21.6 °C 17.4–25.7

Seasonal swing summer↔winter1.10 °C

Max temp (day)25.0 °C 22.3–29.6

Min temp (night)17.7 °C 12.5–22.4

Precipitation144 mm/mo 96.0–222

Air humidity64.7 % 59.1–69.0

Moisture balance17.4 mm/mo -20.2–90.2

Vapour deficit905 Pa 739–1,186

Wind speed1.30 m/s 0.6–3.20

Cloud cover57.6 % 39.5–68.7

CHELSA 1981–2010, ~9 km grid, at location & month of 14 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)