Anarsia molybdota

Meyrick, 1904 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Gelechiidae/Anarsia

At a glance

Occurrence records95

Data sources8

Biological traits0

DNA specimens72

eDNA detections46

Sources8 archives

Databases and archives Anarsia molybdota's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility95 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI46 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics72 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

Catalogue of LifeCOLtaxonomy↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF95 records

Environmental DNA1 datasets · 1 countries46 detections

DNA & barcodingBOLD72 specimens

01Narrative

Anarsia molybdota is a species of moth of the family Gelechiidae. It is found in Australia, where it has been recorded from Queensland, Victoria,Anarsia at funet New South Wales, the Australian Capital Territory, South Australia and Western Australia.Lepidoptera Larvae of Australia The wingspan is . The forewings are fuscous (dusky), irrorated (speckled) with white and with a few scattered dark fuscous scales. There are obscure indications of small darker spots along the margins, and in the disc at three-fourths, as well as a well-defined triangular dark fuscous blotch on the costa about the middle, reaching half across the wing. The hindwings are whitish-fuscous, thinly scaled and semitransparent, but fuscous towards the apex and termen.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding72 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Anarsia molybdota has left across the world's sequence archives.

At a glance

DNA specimens72

BINs2

Marker genes2

eDNA detections46

Countries1

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P639 bp consensus59 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 96% of positions are identical in every specimen.

Where individuals differ — all 24 variable positions, in barcode order

102Tmostly conserved

189Tvariable

213Avariable

282Cvariable

285Tvariable

286Tvariable

311Avariable

342Cvariable

363Tvariable

385Cvariable

417Tmostly conserved

420Tvariable

438Tvariable

459Tvariable

465Gvariable

469Avariable

483Tvariable

525Avariable

561Cvariable

564Tvariable

570Tvariable

600Cvariable

615Cvariable

627Avariable

ACATTATATTTTATTTTTGGAATTTGAGCAGGTATAGTAGGAACATCTTTAAGCTTATTAATTCGAGCAGAATTAGGTAATCCAGGATCT …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)1.6%

Haplotypes8

BINs2

Most divergent pair4.1%

Oceania

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Anarsia acaciaesame genus6.9%Anarsia innoxiellasame genus7.4%Anarsia lineatellasame genus7.7%Anarsia bilbainellasame genus7.7%Anarsia sibiricasame genus7.8%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P18S-5P

animal barcoderibosomal

08Occurrence & distribution

Record type95 records

Wild obs. + sensor90

Museum / vouchered5

Range

Area of Occupancy AOO184 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy97% within 1 km

≤100 m 52≤1 km 10>10 km 2

64 georeferenced · 26 without coordinates

Open the mapobservation + sensor90

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy

no georeferenced coordinates · 5 records without

Open the institutions mapphysical evidence5

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Institution	Specimens
Australian National Insect Collectionlocation not on record	1

1 institutions · 1 of 5 vouchered records shown · 4 without an institution code

09Environmental DNA46 detections

Where the DNA of Anarsia molybdota was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found46

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 46 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median21.3 °C 14.0–24.4

Seasonal swing summer↔winter11.5 °C

Max temp (day)28.0 °C 17.2–30.9

Min temp (night)15.3 °C 9.90–18.3

Precipitation16.1 mm/mo 11.9–88.4

Air humidity51.2 % 49.0–57.8

Moisture balance-139 mm/mo -183–14.3

Vapour deficit1,247 Pa 679–1,542

Wind speed3.20 m/s 2.30–3.40

Cloud cover11.9 % 8.20–18.5

CHELSA 1981–2010, ~9 km grid, at location & month of 46 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)