Anarsia lineatella

Zeller, 1839 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Gelechiidae/Anarsia

At a glance

Occurrence records510

Data sources9

Biological traits2

DNA specimens43

eDNA detections2

Sources9 archives

Databases and archives Anarsia lineatella's data was compiled from.

WikipediaWikimedia Foundation7 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility510 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI2 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics43 specimens↗

NPASSNat. Product Activity & Species Sourcecompounds↗

Open Tree of LifeOpenTreephylogeny backbone↗

Catalogue of LifeCOLtaxonomy↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources2 traits

Chemical compositionNPASS124 compounds

Occurrence & distributionGBIF510 records

Environmental DNA1 datasets · 1 countries2 detections

DNA & barcodingBOLD43 specimens

01Narrative

Anarsia lineatella, the peach twig borer, is a moth of the family Gelechiidae. It is commonly found in Europe, but was introduced to California in the 1880s.Integrated Pest Management for Almonds, Second Edition. University of California Agriculture and Natural Resources Publication 3308. 72-78. Cocoon The wingspan is 11–14 mm. The moths are on wing from June to August depending on the location. The larvae feed on Prunus species, including Prunus avium, Prunus spinosa, Prunus domestica and Prunus insititia. In California, A. lineatella is a significant pest of local almond plantations.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesPantheon

Diet & foraging2

Feeding guild (adult)nectivore

Feeding guild (larval)herbivore

03Chemical composition124 compounds

Compounds documented for Anarsia lineatella across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile5 classes

Cinnamic acids and derivatives18

Flavones14

Menthane monoterpenoids8

Acyclic monoterpenoids8

Menthane monoterpenoids $ Monocyclic monoterpenoids8

Documented compounds124 total

Tissue Source Quantified only

Compound	Amount	Source
(+)-Menthol	present	NPASS
(+)-Perillyl alcohol	present	NPASS
(+)-Ursolic Acid	present	NPASS
(-)-alpha-Pinene	present	NPASS
(-)-Camphene	present	NPASS
(-)-Caryophyllene	present	NPASS
(-)-Linalool	present	NPASS
(-)-Menthol	present	NPASS
(2E)-1-(3-Furanyl)-4-methyl-2-penten-1-one	present	NPASS
(2R)-3-(3,4-dihydroxyphenyl)-2-hydroxypropanamide	present	NPASS

05DNA & barcoding43 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Anarsia lineatella has left across the world's sequence archives.

At a glance

DNA specimens43

BINs6

Marker genes1

eDNA detections2

Countries12

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus39 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 95% of positions are identical in every specimen.

Where individuals differ — all 31 variable positions, in barcode order

29Gmostly conserved

49Tvariable

100Gvariable

166Amostly conserved

172Tvariable

181Amostly conserved

217Amostly conserved

220Cvariable

235Tmostly conserved

259Cvariable

274Cmostly conserved

292Tmostly conserved

340Tvariable

352Tmostly conserved

364Cmostly conserved

374Gmostly conserved

400Cvariable

401Cvariable

448Cvariable

463Cvariable

475Tmostly conserved

484Cmostly conserved

517Avariable

556Amostly conserved

565Amostly conserved

574Amostly conserved

578Cvariable

601Cvariable

604Tmostly conserved

616Tmostly conserved

646Tvariable

AACATTATATTTTATTTTTGGAATTTGAGCAGGTATAGTAGGAACATCTTTAAGTTTATTAATTCGAGCAGAATTAGGTAATCCTGGATC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)1.9%

Haplotypes15

BINs6

Most divergent pair3.6%

EuropeN.AmericaAsia

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Anarsia innoxiellasame genus1.8%Anarsia acaciaesame genus4.7%Anarsia bilbainellasame genus5.8%Anarsia sibiricasame genus6.1%Anarsia spartiellasame genus6.4%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type510 records

Wild obs. + sensor251

Museum / vouchered238

Other21

Range

Area of Occupancy AOO988 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy53% within 1 km

≤100 m 48≤1 km 51≤10 km 80>10 km 7

186 georeferenced · 65 without coordinates

Open the mapobservation + sensor251

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy77% within 1 km

≤100 m 14≤1 km 76≤10 km 26>10 km 1

117 georeferenced · 121 without coordinates

Open the institutions mapphysical evidence238

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions12 of 28 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Zoological Museum of the University of Chittagong, Bangladeshlocation not on record	36
Tartu, EE	29
Provincia di Livornolocation not on record	23
Tilburg, NL	17
Instytut Systematyki i Ewolucji Zwierząt Polskiej Akademii Nauklocation not on record	12
European Distributed Institute of Taxonomy (EDIT)location not on record	8
Nijmegen, NL	8
Washington, US	8
Vernal, US	7
Stockholm, SE	7
East Lansing, US	6
ZSMlocation not on record	5
DanishLepidopterologicalSocietylocation not on record	4
Naturalis Biodiversity Centerlocation not on record	3
Bavarian State Collection of Zoologylocation not on record	3
Smithsonian Institution, National Museum of Natural Historylocation not on record	2
Salzburg, AT	2
University of Kaiserslauternlocation not on record	2
US	2
Philadelphia, US	1
Research Collection of Hartmut Wegnerlocation not on record	1
ASUlocation not on record	1
St. Paul, US	1
University of Alberta Museums (UAM)location not on record	1
Essig Museum of Entomologylocation not on record	1
Essig Museumlocation not on record	1
South Kensington, GB	1
SLU Artdatabankenlocation not on record	1

28 institutions · 193 of 238 vouchered records shown · 45 without an institution code

09Environmental DNA2 detections

Where the DNA of Anarsia lineatella was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found2

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 2 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median19.1 °C 19.0–19.1

Seasonal swing summer↔winter19.6 °C

Max temp (day)23.6 °C 23.5–23.6

Min temp (night)14.2 °C 14.1–14.3

Precipitation91.1 mm/mo 87.1–95.1

Air humidity57.8 % 57.7–57.9

Moisture balance-43.4 mm/mo -49.1–-37.7

Vapour deficit936 Pa 929–943

Wind speed2.70 m/s 2.50–2.90

Cloud cover31.5 %

CHELSA 1981–2010, ~9 km grid, at location & month of 2 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)