Anarsia spartiella

(Schrank, 1802) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Gelechiidae/Anarsia

At a glance

Occurrence records678

Data sources10

Biological traits2

DNA specimens18

eDNA detections17

Sources10 archives

Databases and archives Anarsia spartiella's data was compiled from.

WikipediaWikimedia Foundation5 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility678 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI17 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics18 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GoaTGenomes on a Tree · Sangergenome & karyotype↗

NCBIUS National Library of Medicinegenome & karyotype↗

Catalogue of LifeCOLtaxonomy↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources2 traits

Occurrence & distributionGBIF678 records

Environmental DNA1 datasets · 5 countries17 detections

DNA & barcodingBOLD18 specimens

Genome at a glanceGoaT · NCBI≈430 Mbp

01Narrative

Anarsia spartiella, the Wanstead grey, is a moth of the family Gelechiidae. It is found in most of Europe. The wingspan is 12–15 mm. The forewings are grey-whitish, finely irrorated with fuscous, often with some black scales, occasionally much suffused with dark fuscous ; several short oblique dark fuscous costal marks, one in middle largest ; stigmata sometimes indicated by black dashes ; often a black terminal spot below apex. Hindwings are light grey. The larva is dark brown ; head and plate of 2 black Meyrick, E., 1895 A Handbook of British Lepidoptera MacMillan, London pdf Keys and description Adults are on wing from June to August. The larvae feed on Ulex and Cytisus species, as well as Genista tinctoria. They spin the shoots of their host plant and feed within.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesPantheon

Diet & foraging2

Feeding guild (adult)nectivore

Feeding guild (larval)herbivore

05DNA & barcoding18 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Anarsia spartiella has left across the world's sequence archives.

At a glance

DNA specimens18

BINs2

Marker genes1

eDNA detections17

Countries6

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus14 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 95% of positions are identical in every specimen.

Where individuals differ — all 35 variable positions, in barcode order

29Gmostly conserved

30Cmostly conserved

40Amostly conserved

67Amostly conserved

118Cmostly conserved

268Amostly conserved

271Cmostly conserved

280Tmostly conserved

283Cmostly conserved

340Cmostly conserved

364Amostly conserved

367Cvariable

373Amostly conserved

374Gmostly conserved

397Tmostly conserved

400Tmostly conserved

421Cmostly conserved

436Tmostly conserved

466Amostly conserved

470Amostly conserved

477Gmostly conserved

505Tmostly conserved

529Tmostly conserved

536Cmostly conserved

542Cmostly conserved

553Gvariable

562Gvariable

565Amostly conserved

578Tmostly conserved

580Amostly conserved

607Cvariable

613Cmostly conserved

622Tmostly conserved

631Avariable

646Tmostly conserved

AACATTATATTTTATTTTTGGAATTTGAGCAGGAATAGTAGGAACATCTTTAAGTTTATTAATTCGAGCAGAATTAGGTAATCCTGGATC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)1.3%

Haplotypes9

BINs2

Most divergent pair3.8%

Europe

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Anarsia bilbainellasame genus2.7%Anarsia sibiricasame genus4.3%Anarsia leberonellasame genus4.4%Anarsia innoxiellasame genus5.9%Anarsia acaciaesame genus6.2%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

06Genome at a glanceGoaT · NCBI

The complete instruction manual Anarsia spartiella carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Genome sizehow big the whole instruction manual is

Genome size≈430 225 814 bp assembly estimate

Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).

BACTERIUM Carsonella ruddii0.00016 Gb

FUNGUS0.04 Gb

INSECT0.25 Gb

THIS GENOME Anarsia spartiella0.43 Gb

HUMAN3.2 Gb

WHEAT17 Gb

FERN Tmesipteris160.45 Gb

Sequencing statusassembly quality — how far to trust these numbers

Assembly level tells you how finished the sequence is — from fragmented contigs, through scaffolds, up to a full chromosome-level assembly. BUSCO % estimates completeness: the share of genes expected to be present that were actually found. These describe the data quality, not the organism.

Assembly levelChromosome

Completeness99.6% BUSCO

08Occurrence & distribution

Record type678 records

Wild obs. + sensor596

Museum / vouchered72

Other10

Range

Area of Occupancy AOO1 244 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy33% within 1 km

≤100 m 113≤1 km 64≤10 km 352

529 georeferenced · 67 without coordinates

Open the mapobservation + sensor596

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy89% within 1 km

≤100 m 6≤1 km 33≤10 km 5

44 georeferenced · 28 without coordinates

Open the institutions mapphysical evidence72

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions3 of 13 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Provincia di Livornolocation not on record	19
DanishLepidopterologicalSocietylocation not on record	12
Tilburg, NL	4
National Institute of Biological Resourceslocation not on record	3
European Distributed Institute of Taxonomy (EDIT)location not on record	3
ZSMlocation not on record	2
Nijmegen, NL	2
DABUHlocation not on record	2
Zoological Museum of the University of Chittagong, Bangladeshlocation not on record	1
University of Kaiserslauternlocation not on record	1
Natural History Museum, Londonlocation not on record	1
Bavarian State Collection of Zoologylocation not on record	1
South Kensington, GB	1

13 institutions · 52 of 72 vouchered records shown · 20 without an institution code

09Environmental DNA17 detections

Where the DNA of Anarsia spartiella was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found17

Studies independent surveys1

Countries5

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 17 detections have coordinates

Open the map5 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median17.9 °C 14.5–19.0

Seasonal swing summer↔winter19.9 °C

Max temp (day)22.0 °C 18.6–24.6

Min temp (night)11.8 °C 9.00–13.8

Precipitation64.3 mm/mo 35.9–82.3

Air humidity56.6 % 53.2–58.4

Moisture balance-74.5 mm/mo -119–-35.4

Vapour deficit890 Pa 691–1,017

Wind speed2.90 m/s 1.70–3.30

Cloud cover34.3 % 28.9–37.3

CHELSA 1981–2010, ~9 km grid, at location & month of 15 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)