Anaphothrips sudanensis

Trybom, 1911 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Thysanoptera/Thripidae/Anaphothrips

At a glance

Occurrence records77

Data sources6

Biological traits0

DNA specimens36

eDNA detections5

Sources6 archives

Databases and archives Anaphothrips sudanensis's data was compiled from.

GBIFGlobal Biodiversity Information Facility77 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI5 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics36 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

Catalogue of LifeCOLtaxonomy↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page3 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

Occurrence & distributionGBIF77 records

Environmental DNA1 datasets · 2 countries5 detections

DNA & barcodingBOLD36 specimens

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding36 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Anaphothrips sudanensis has left across the world's sequence archives.

At a glance

DNA specimens36

BINs2

Marker genes3

eDNA detections5

Countries4

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P650 bp consensus31 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 96% of positions are identical in every specimen.

Where individuals differ — all 27 variable positions, in barcode order

1Tmostly conserved

66Amostly conserved

123Cmostly conserved

189Gmostly conserved

283Cmostly conserved

369Cmostly conserved

378Cmostly conserved

414Cvariable

432Tmostly conserved

462Gmostly conserved

489Cmostly conserved

552Gmostly conserved

573Tmostly conserved

591Gvariable

627Cmostly conserved

637Tmostly conserved

638Amostly conserved

639Tmostly conserved

640Cmostly conserved

642Amostly conserved

643Cmostly conserved

644Amostly conserved

645Cmostly conserved

647Tmostly conserved

648Tmostly conserved

649Tmostly conserved

650Tmostly conserved

TTATACTTTTTATTTGGATTTTGATCAGGAATACTAGGACTTTCATTAAGAATATTAATTCGTTTAAACTTACGTAGTCCAATAAAATTA …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)1.7%

Haplotypes6

BINs2

Most divergent pair7.7%

AsiaOther

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Anaphothrips badiussame genus14.6%Anaphothrips obscurussame genus15.4%Anaphothrips ripicolasame genus15.7%Oxythrips kochummanisame family16.0%Oxythrips divisussame family16.3%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P18S-3P18S-5P

animal barcoderibosomal

08Occurrence & distribution

Record type77 records

Museum / vouchered77

Range

Area of Occupancy AOO196 km²

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy0% within 1 km

≤10 km 35>10 km 1

36 georeferenced · 41 without coordinates

Open the institutions mapphysical evidence77

10Collections & institutions

Institution	Specimens
Australian National Fish Collectionlocation not on record	36
DPIlocation not on record	20
University of Alberta Museums (UAM)location not on record	5
National Institute for Biotechnology and Genetic Engineeringlocation not on record	1

4 institutions · 62 of 77 vouchered records shown · 14 without an institution code

09Environmental DNA5 detections

Where the DNA of Anaphothrips sudanensis was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found5

Studies independent surveys1

Countries2

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 5 detections have coordinates

Open the map2 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median27.0 °C 26.5–27.4

Seasonal swing summer↔winter15.8 °C

Max temp (day)32.4 °C 31.2–33.6

Min temp (night)20.7 °C 19.4–22.0

Precipitation181 mm/mo 56.7–306

Air humidity55.0 % 46.7–63.4

Moisture balance14.8 mm/mo -113–143

Vapour deficit1,622 Pa 1,272–1,972

Wind speed2.60 m/s 2.50–2.60

Cloud cover38.8 % 37.5–40.1

CHELSA 1981–2010, ~9 km grid, at location & month of 2 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)