Anaphothrips obscurus

(Muller, 1776) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Thysanoptera/Thripidae/Anaphothrips

At a glance

Occurrence records959

Data sources6

Biological traits0

DNA specimens134

eDNA detections356

Sources6 archives

Databases and archives Anaphothrips obscurus's data was compiled from.

GBIFGlobal Biodiversity Information Facility959 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI356 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics134 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

Catalogue of LifeCOLtaxonomy↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page3 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

Occurrence & distributionGBIF959 records

Environmental DNA6 datasets · 10 countries356 detections

DNA & barcodingBOLD134 specimens

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding134 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Anaphothrips obscurus has left across the world's sequence archives.

At a glance

DNA specimens134

BINs1

Marker genes2

eDNA detections356

Countries12

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P655 bp consensus107 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 100% of positions are identical in every specimen.

Where individuals differ — all 1 variable positions, in barcode order

217Amostly conserved

AATTTTGTATTTTATATTTGGATTTTGATCAGGTATACTAGGTTTATCATTAAGAATATTAATTCGTATAAATTTACGTACACCTATAAA …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.20%

Haplotypes5

BIN1

Most divergent pair1.2%

N.AmericaEurope

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Anaphothrips ripicolasame genus9.3%Anaphothrips badiussame genus9.9%Anaphothrips cameronisame genus10.2%Anaphothrips sudanensissame genus15.4%Scirtothrips oligochaetussame family16.3%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P18S-3P

animal barcoderibosomal

Organelle genome

Besides the big genome in the nucleus, cells carry a small, circular loop of DNA inside the cell's energy factories — the mitochondria. It is inherited almost only from the mother and is a leftover from ancient bacteria that moved into the cell. The mitochondrial markers above (ND*, COX, CYTB…) are read from exactly this loop. Outer ring = one strand, inner ring = the other.

▸ Tap any coloured segment — or a gene chip — to see what it is

Mitochondrion

NC_035510 ↗ · 12 protein · 22 tRNA · 2 rRNA

COX1COX2COX3ND3CYTBND2ND1ATP8ATP6ND5ND4ND612S ribosomal RNA16S ribosomal RNA

◖ violet arc = the COI-5P barcode — the ~650 bp read used to ID this species

Pick a coloured segment on the ring — or a gene chip — to read what that gene does.

protein-codingrRNAtRNA

08Occurrence & distribution

Record type959 records

Wild obs. + sensor138

Museum / vouchered805

Other16

Range

Area of Occupancy AOO1 376 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy94% within 1 km

≤100 m 9≤1 km 110≤10 km 7>10 km 1

127 georeferenced · 11 without coordinates

Open the mapobservation + sensor138

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy79% within 1 km

≤100 m 84≤1 km 131≤10 km 55>10 km 1

271 georeferenced · 534 without coordinates

Open the institutions mapphysical evidence805

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions9 of 24 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
DPIlocation not on record	144
MWLRlocation not on record	125
Uniwersytet Marii Curie-Skłodowskiejlocation not on record	95
University of Alberta Museums (UAM)location not on record	84
New Zealand Arthropod Collectionlocation not on record	64
SLU Artdatabankenlocation not on record	61
MZLUlocation not on record	48
University of Guelph, Centre for Biodiversity Genomicslocation not on record	33
Norwegian Institute of Bioeconomy Researchlocation not on record	24
Australian National Fish Collectionlocation not on record	22
NTNU-VMlocation not on record	19
US	6
Tartu, EE	5
Edmonton, CA	4
BioFokuslocation not on record	4
Mexico City, MX	4
Kuopio, FI	3
Museum of Zoology at the University of Bergen, Invertebrate Collectionlocation not on record	2
NTNU University Museum, Department of Natural Historylocation not on record	2
Helsinki, FI	2
Provo, US	1
Auckland, NZ	1
Natick, US	1
Tasmanian Museum & Art Gallerylocation not on record	1

24 institutions · 755 of 805 vouchered records shown · 50 without an institution code

09Environmental DNA356 detections

Where the DNA of Anaphothrips obscurus was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found356

Studies independent surveys6

Countries10

Verifiable raw sequence linked175

Signal confidence: moderateweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 356 detections have coordinates

Open the map10 countries0

4. Native Grassland | 4.4. Temperate Grassland1.1 Boreal ForestLakefarm1. Forest & Woodland|1.5. Subtropical/Tropic…1. Forest & Woodland|1.1. Boreal Forest

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median14.6 °C 3.70–18.0

Seasonal swing summer↔winter22.7 °C

Max temp (day)18.2 °C 6.80–23.2

Min temp (night)10.7 °C 1.20–15.6

Precipitation86.9 mm/mo 47.1–124

Air humidity60.5 % 55.4–63.4

Moisture balance-42.2 mm/mo -75.0–73.5

Vapour deficit661 Pa 310–867

Wind speed4.00 m/s 2.70–5.70

Cloud cover46.0 % 36.8–57.9

CHELSA 1981–2010, ~9 km grid, at location & month of 340 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)