Anaphes nitens

(Girault, 1928) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Hymenoptera/Mymaridae/Anaphes

At a glance

Occurrence records13

Data sources7

Biological traits0

DNA specimens12

eDNA detections13

Sources7 archives

Databases and archives Anaphes nitens's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility13 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI13 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics12 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF13 records

Environmental DNA1 datasets · 4 countries13 detections

DNA & barcodingBOLD12 specimens

01Narrative

Anaphes nitens is a species of fairyfly, a chalcid wasp in the family Mymaridae. Native to Australia, it is an egg parasitoid of the gum tree snout beetle (Gonipterus scutellatus), a pest of Eucalyptus trees, and has been used in biological pest control of that species.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding12 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Anaphes nitens has left across the world's sequence archives.

At a glance

DNA specimens12

BINs1

Marker genes3

eDNA detections13

Countries5

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P646 bp consensus6 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 99% of positions are identical in every specimen.

Diversity (π)0.44%

Haplotypes2

BIN1

Most divergent pair0.31%

Where individuals differ — all 6 variable positions, in barcode order

107Tvariable

168Tmostly conserved

231Cmostly conserved

234Gvariable

415Tmostly conserved

636Cvariable

TTATATTTTATTTTTGGAATATGATCAGGATTTTTGGGGTTATCATTAAGAATAATAATTCGATTAGAATTAGGTTCTTCTGGTTCATTT …

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Anaphes pectoralissame genus7.0%Anaphes flavipessame genus8.5%Anaphes fuscipennissame genus8.7%Anaphes listronotisame genus8.8%Anaphes sordidatussame genus9.4%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-3P★COI-5PCYTB

animal barcodemitochondrial

08Occurrence & distribution

Record type13 records

Museum / vouchered13

Origin

Introduced1

Range

Area of Occupancy AOO40 km²

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy14% within 1 km

≤1 km 1≤10 km 5>10 km 1

7 georeferenced · 6 without coordinates

Open the institutions mapphysical evidence13

10Collections & institutions

Holding institutions1 of 5 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Museums Victorialocation not on record	5
Agricultural Research Council-Plant Protection Research Institutelocation not on record	4
Auckland, NZ	2
MWLRlocation not on record	1
New Zealand Arthropod Collectionlocation not on record	1

5 institutions · 13 of 13 vouchered records shown

09Environmental DNA13 detections

Where the DNA of Anaphes nitens was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found13

Studies independent surveys1

Countries4

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 13 detections have coordinates

Open the map4 countries0

14. Artificial - Terrestrial | 14.5 Urban Ar…Forest

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median13.5 °C 11.7–18.8

Seasonal swing summer↔winter9.80 °C

Max temp (day)16.4 °C 14.7–22.9

Min temp (night)9.10 °C 6.90–15.5

Precipitation120 mm/mo 57.4–160

Air humidity61.7 % 57.4–62.7

Moisture balance23.9 mm/mo

Vapour deficit611 Pa 512–829

Wind speed4.30 m/s

Cloud cover29.2 % 16.4–36.1

CHELSA 1981–2010, ~9 km grid, at location & month of 10 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)