Anaphes fuscipennis

Haliday, 1833 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Hymenoptera/Mymaridae/Anaphes

At a glance

Occurrence records44

Data sources6

Biological traits0

DNA specimens68

eDNA detections65

Sources6 archives

Databases and archives Anaphes fuscipennis's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility44 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI65 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics68 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF44 records

Environmental DNA2 datasets · 8 countries65 detections

DNA & barcodingBOLD68 specimens

01Narrative

Anaphes fuscipennis is een vliesvleugelig insect uit de familie Mymaridae. De wetenschappelijke naam is voor het eerst geldig gepubliceerd in 1833 door Haliday.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding68 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Anaphes fuscipennis has left across the world's sequence archives.

At a glance

DNA specimens68

BINs1

Marker genes1

eDNA detections65

Countries8

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P651 bp consensus37 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 87% of positions are identical in every specimen.

Where individuals differ — all 85 variable positions, in barcode order

57Avariable

84Tvariable

87Tvariable

282Amostly conserved

303Tmostly conserved

435Amostly conserved

488Tmostly conserved

489Tmostly conserved

491Cmostly conserved

492Tmostly conserved

493Tmostly conserved

495Amostly conserved

496Tmostly conserved

497Tmostly conserved

499Amostly conserved

500Gmostly conserved

503Gmostly conserved

504Amostly conserved

505Tmostly conserved

506Cmostly conserved

508Amostly conserved

509Tmostly conserved

511Amostly conserved

512Tmostly conserved

513Gvariable

514Tmostly conserved

518Cmostly conserved

519Amostly conserved

520Gmostly conserved

521Cmostly conserved

524Tmostly conserved

525Tmostly conserved

526Tmostly conserved

527Tmostly conserved

529Tmostly conserved

531Amostly conserved

539Cmostly conserved

544Cmostly conserved

546Tmostly conserved

547Gmostly conserved

550Tmostly conserved

551Tmostly conserved

552Amostly conserved

554Cmostly conserved

555Tmostly conserved

556Gmostly conserved

557Gmostly conserved

558Tmostly conserved

561Amostly conserved

562Amostly conserved

563Tmostly conserved

565Amostly conserved

570Amostly conserved

571Tmostly conserved

572Tmostly conserved

574Tmostly conserved

579Tmostly conserved

580Gmostly conserved

581Amostly conserved

582Tmostly conserved

583Cmostly conserved

584Gmostly conserved

585Amostly conserved

586Amostly conserved

589Tmostly conserved

590Tmostly conserved

595Amostly conserved

596Cmostly conserved

597Tmostly conserved

598Tmostly conserved

599Cmostly conserved

601Tmostly conserved

602Tmostly conserved

605Tmostly conserved

607Gmostly conserved

608Amostly conserved

610Cmostly conserved

611Cmostly conserved

612Tvariable

614Cmostly conserved

616Gmostly conserved

617Gmostly conserved

618Amostly conserved

620Gmostly conserved

624Amostly conserved

ATTTTATATTTTATTTTTGGAATATGAGCAGGATTTATAGGATTATCATTAAGAATATTAATTCGATTAGAATTAGGATCTTCTGGTGAA …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)3.5%

Haplotypes3

BIN1

Most divergent pair1.8%

N.AmericaAsiaEurope

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Anaphes pectoralissame genus6.6%Anaphes listronotisame genus7.1%Anaphes sordidatussame genus7.3%Anaphes flavipessame genus7.8%Anaphes nitenssame genus8.7%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type44 records

Wild obs. + sensor1

Museum / vouchered43

Range

Area of Occupancy AOO112 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy0% within 1 km

≤10 km 1

1 georeferenced

Open the mapobservation + sensor1

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy

no georeferenced coordinates · 43 records without

Open the institutions mapphysical evidence43

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Institution	Specimens
University of Guelph, Centre for Biodiversity Genomicslocation not on record	19
Centre for Biodiversity Genomicslocation not on record	4
Wellcome Sanger Institutelocation not on record	1

3 institutions · 24 of 43 vouchered records shown · 19 without an institution code

09Environmental DNA65 detections

Where the DNA of Anaphes fuscipennis was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found65

Studies independent surveys2

Countries8

Verifiable raw sequence linked1

Signal confidence: moderateweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 65 detections have coordinates

Open the map8 countries0

4. Native GrasslandGrassland5. Wetlands (inland)|5.4. Bogs, Marshes, Swa…Temperate mixed forest14. Artificial - Terrestrial|14.5 Urban AreasForest

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median11.9 °C 6.20–15.6

Seasonal swing summer↔winter26.1 °C

Max temp (day)15.5 °C 10.1–18.9

Min temp (night)7.50 °C 1.80–9.90

Precipitation84.2 mm/mo 65.4–124

Air humidity55.8 % 55.2–61.4

Moisture balance-15.4 mm/mo -42.9–26.4

Vapour deficit556 Pa 420–702

Wind speed3.70 m/s 2.50–4.80

Cloud cover46.0 % 35.5–53.2

CHELSA 1981–2010, ~9 km grid, at location & month of 65 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)