Anaphe reticulata

Walker, 1855 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Notodontidae/Anaphe

At a glance

Occurrence records470

Data sources6

Biological traits0

DNA specimens5

eDNA detections0

Sources6 archives

Databases and archives Anaphe reticulata's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility470 records↗

BOLD SystemsCentre for Biodiversity Genomics5 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page3 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF470 records

DNA & barcodingBOLD5 specimens

01Narrative

Anaphe reticulata is a moth of the family Notodontidae. It was described by Francis Walker in 1855. It is found in Angola, Eritrea, Ivory Coast, Malawi, Mozambique and South Africa. The caterpillars can be seen precessing in single file along the ground or up trees. Allegedly they will cause a rash if touched.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding5 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Anaphe reticulata has left across the world's sequence archives.

At a glance

DNA specimens5

BINs1

Marker genes1

Countries2

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P654 bp consensus3 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 100% of positions are identical in every specimen.

Diversity (π)0.00%

Haplotypes1

BIN1

TTTATATTTTATTTTTGGAATTTGAGCTGGTATAGTGGGAACTTCTTTAAGTTTATTAATTCGAACAGAATTAGGTAATCCTGGATCATT …

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Anaphe pandasame genus3.8%Idaea incisariasame order8.6%Chorodnodes rothisame order8.9%Vietteia terstrigellasame order9.3%Coleophora sarehmasame order9.3%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type470 records

Wild obs. + sensor434

Museum / vouchered36

Range

Area of Occupancy AOO1 064 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy92% within 1 km

≤100 m 258≤1 km 57≤10 km 21>10 km 6

342 georeferenced · 92 without coordinates

Open the mapobservation + sensor434

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy6% within 1 km

≤1 km 1≤10 km 12>10 km 3

16 georeferenced · 20 without coordinates

Open the institutions mapphysical evidence36

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions1 of 6 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Durban Natural Science Museumlocation not on record	16
New Haven, US	10
Natural History Museum Rotterdamlocation not on record	4
ZSMlocation not on record	2
Bavarian State Collection of Zoologylocation not on record	2
Museu Nacional de História Natural e da Ciêncialocation not on record	1

6 institutions · 35 of 36 vouchered records shown · 1 without an institution code

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)