Anaphe panda

Boisduval, 1847 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Notodontidae/Anaphe

At a glance

Occurrence records170

Data sources7

Biological traits0

DNA specimens11

eDNA detections18

Sources7 archives

Databases and archives Anaphe panda's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility170 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI18 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics11 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF170 records

Environmental DNA1 datasets · 5 countries18 detections

DNA & barcodingBOLD11 specimens

01Narrative

Anaphe panda is a moth of the family Notodontidae. It was described by Jean Baptiste Boisduval in 1847. It is found in Cameroon, the Democratic Republic of the Congo, Equatorial Guinea, Kenya, Malawi, South Africa, Tanzania and the Gambia. The larvae have been recorded feeding on Bridelia micrantha. Larvae are eaten in Central Africa and are especially liked because of their high fat content.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding11 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Anaphe panda has left across the world's sequence archives.

At a glance

DNA specimens11

BINs1

Marker genes1

eDNA detections18

Countries5

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus11 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 100% of positions are identical in every specimen.

Where individuals differ — all 3 variable positions, in barcode order

313Cvariable

358Tmostly conserved

463Tvariable

AACTTTATATTTTATTTTTGGAATTTGAGCTGGAATAGTAGGAACTTCTTTAAGTTTATTAATTCGAACAGAATTAGGTAATCCAGGATC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.19%

Haplotypes3

BIN1

Most divergent pair0.30%

Africa

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Anaphe reticulatasame genus3.8%Allochrostes impunctatasame order8.5%Coleophora berberasame order8.7%Coleophora sarehmasame order8.8%Diasemiopsis ramburialissame order9.1%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type170 records

Wild obs. + sensor71

Museum / vouchered99

Range

Area of Occupancy AOO328 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy88% within 1 km

≤100 m 37≤1 km 15≤10 km 4>10 km 3

59 georeferenced · 12 without coordinates

Open the mapobservation + sensor71

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy100% within 1 km

≤100 m 3≤1 km 1

4 georeferenced · 95 without coordinates

Open the institutions mapphysical evidence99

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions1 of 3 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Uniwersytet Jagiellońskilocation not on record	57
Durban Natural Science Museumlocation not on record	19
Tartu, EE	3

3 institutions · 79 of 99 vouchered records shown · 20 without an institution code

09Environmental DNA18 detections

Where the DNA of Anaphe panda was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found18

Studies independent surveys1

Countries5

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 18 detections have coordinates

Open the map5 countries0

Tropical rainforest

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median20.9 °C 19.6–21.6

Seasonal swing summer↔winter4.20 °C

Max temp (day)27.1 °C 24.5–27.9

Min temp (night)15.6 °C 14.5–16.6

Precipitation104 mm/mo 90.0–171

Air humidity55.6 % 55.4–66.3

Moisture balance-28.0 mm/mo -48.2–43.8

Vapour deficit1,098 Pa 893–1,129

Wind speed1.50 m/s 1.30–2.50

Cloud cover41.5 % 26.0–48.5

CHELSA 1981–2010, ~9 km grid, at location & month of 18 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)