Anapagurus hyndmanni

(Bell, 1846) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Malacostraca/Decapoda/Paguridae/Anapagurus

At a glance

Occurrence records7 702

Data sources7

Biological traits2

DNA specimens5

eDNA detections77

Sources7 archives

Databases and archives Anapagurus hyndmanni's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility4 446 records↗

OBISOcean Biodiversity Information System3 256 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI77 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics5 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources2 traits

Occurrence & distributionGBIF · OBIS7 702 records

Environmental DNA2 datasets · 2 countries77 detections

DNA & barcodingBOLD5 specimens

01Narrative

Anapagurus hyndmanni is een tienpotigensoort uit de familie van de Paguridae. De wetenschappelijke naam van de soort is voor het eerst geldig gepubliceerd in 1846 door Bell.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesSeaLifeBase

Habitat & environment2

Habitat saltwateryes

Habitat zonebenthic

05DNA & barcoding5 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Anapagurus hyndmanni has left across the world's sequence archives.

At a glance

DNA specimens5

BINs1

Marker genes1

eDNA detections77

Countries2

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P666 bp consensus5 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 99% of positions are identical in every specimen.

Where individuals differ — all 8 variable positions, in barcode order

266Tmostly conserved

385Tmostly conserved

421Amostly conserved

499Amostly conserved

538Cmostly conserved

583Amostly conserved

619Cmostly conserved

623Gmostly conserved

TGGTACTTTATATTTTATTTTCGGTGCTTGAGCCGGAATAGTTGGAACTTCCCTTAGTTTAGTAATTCGAGCTGAATTAGGACAACCTGG …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.48%

Haplotypes3

BIN1

Most divergent pair0.90%

OtherEurope

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Anapagurus alboranensissame genus13.8%Pagurus mbizisame family13.9%Anapagurus chiroacanthussame genus14.2%Anapagurus congolensissame genus14.4%Anapagurus hendersonisame genus14.9%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type7 702 records

Wild obs. + sensor2 990

Museum / vouchered3 270

Other1 442

Origin

Native3

Range

Area of Occupancy AOO5 652 km²

Depth

0–200 m sunlit1 134

200–1000 m twilight2

1–4 km midnight0

>4 km abyssal0

median 19.4 m · max 214 m · 1 136 records with depth

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy57% within 1 km

≤100 m 1 390≤1 km 24≤10 km 1 060>10 km 5

2 479 georeferenced · 511 without coordinates

Open the mapobservation + sensor2 990

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy97% within 1 km

≤100 m 180≤1 km 34≤10 km 6

220 georeferenced · 3 050 without coordinates

Open the institutions mapphysical evidence3 270

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions6 of 16 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Institut Francais pour l'Etude de la Merlocation not on record	663
CEFASlocation not on record	506
486location not on record	378
Station Biologique de Roscoff (EDMO:521)location not on record	164
DASSHlocation not on record	23
IEOlocation not on record	13
Paris, FR	10
Citadel Hill, GB	9
South Kensington, GB	9
Brussels, BE	6
RBINS-Scientific Heritagelocation not on record	5
Washington, US	3
Tromsø, NO	2
SNSDlocation not on record	2
630location not on record	1
Research Institute for Agriculture, Fisheries and Food (ILVO)location not on record	1

16 institutions · 1 795 of 3 270 vouchered records shown · 73 without an institution code

09Environmental DNA77 detections

Where the DNA of Anapagurus hyndmanni was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found77

Studies independent surveys2

Countries2

Verifiable raw sequence linked72

Signal confidence: moderateweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 77 detections have coordinates

Open the map2 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median13.1 °C 13.1–16.2

Seasonal swing summer↔winter12.5 °C

Max temp (day)14.4 °C 14.4–17.2

Min temp (night)11.9 °C 11.9–15.1

Precipitation101 mm/mo 78.8–101

Air humidity63.3 % 62.5–63.3

Vapour deficit551 Pa 551–686

Cloud cover46.2 % 43.5–46.2

CHELSA 1981–2010, ~9 km grid, at location & month of 73 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Anapagurus hyndmanni

At a glance

Sources7 archives

Habitat & environment2

At a glance

Record type7 702 records

Origin

Range

Depth

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions6 of 16 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type7 702 records