Anapagurus chiroacanthus

(Lilljeborg, 1856) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Malacostraca/Decapoda/Paguridae/Anapagurus

At a glance

Occurrence records1 800

Data sources6

Biological traits2

DNA specimens9

eDNA detections2

Sources6 archives

Databases and archives Anapagurus chiroacanthus's data was compiled from.

GBIFGlobal Biodiversity Information Facility1 181 records↗

OBISOcean Biodiversity Information System619 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI2 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics9 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

Traits & measurements1 literature sources2 traits

Occurrence & distributionGBIF · OBIS1 800 records

Environmental DNA1 datasets · 0 countries2 detections

DNA & barcodingBOLD9 specimens

02Traits & measurements

SourcesSeaLifeBase

Habitat & environment2

Habitat saltwateryes

Habitat zonebenthic

05DNA & barcoding9 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Anapagurus chiroacanthus has left across the world's sequence archives.

At a glance

DNA specimens9

BINs2

Marker genes2

eDNA detections2

Countries1

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P657 bp consensus6 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 98% of positions are identical in every specimen.

Diversity (π)0.72%

Haplotypes2

BINs2

Most divergent pair2.1%

Where individuals differ — all 14 variable positions, in barcode order

45Cmostly conserved

114Cmostly conserved

219Amostly conserved

279Cmostly conserved

297Amostly conserved

375Gmostly conserved

387Gmostly conserved

417Tmostly conserved

438Gmostly conserved

468Tmostly conserved

489Tmostly conserved

492Tmostly conserved

555Gmostly conserved

594Cmostly conserved

ACTTTATATTTTATTTTCGGAGCTTGAGCCGGAATAGTAGGAACCTCCCTTAGTTTAGTAATTCGAGCAGAGTTAGGTCAACCAGGTAGA …

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Eumunida capillatasame order12.9%Eumunida laevimanasame order13.5%Eumunida smithiisame order13.7%Propagurus gaudichaudiisame family13.9%Anapagurus congolensissame genus13.9%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P18S-5P

animal barcoderibosomal

08Occurrence & distribution

Record type1 800 records

Wild obs. + sensor389

Museum / vouchered1 131

Other280

Range

Area of Occupancy AOO2 112 km²

Depth

0–200 m sunlit229

200–1000 m twilight3

1–4 km midnight0

>4 km abyssal0

median 30.5 m · max 314 m · 232 records with depth

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy79% within 1 km

≤100 m 253≤1 km 22≤10 km 68>10 km 3

346 georeferenced · 43 without coordinates

Open the mapobservation + sensor389

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy33% within 1 km

≤100 m 42≤1 km 57≤10 km 200>10 km 3

302 georeferenced · 829 without coordinates

Open the institutions mapphysical evidence1 131

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions8 of 24 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Gothenburg, SE	270
SLU Artdatabankenlocation not on record	199
Stockholm, SE	91
University of Oslo (UiO)location not on record	51
CEFASlocation not on record	33
486location not on record	22
Institut Francais pour l'Etude de la Merlocation not on record	22
Frankfurt am Main	14
NTNU-VMlocation not on record	9
IEOlocation not on record	8
ICM-CSIClocation not on record	8
Bergen, NO	7
RBINS-Scientific Heritagelocation not on record	3
Brussels, BE	3
Cambridge, US	2
MZLUlocation not on record	2
Goteborg Natural History Museumlocation not on record	2
Eco laboratory geochemistry Benthic Environments UMR 8222 (4503)location not on record	1
Université de Liège Underwater research and oceanographic station (4501)location not on record	1
Tromsø, NO	1
730location not on record	1
BioFokuslocation not on record	1
South Kensington, GB	1
DASSHlocation not on record	1

24 institutions · 753 of 1 131 vouchered records shown · 5 without an institution code

09Environmental DNA2 detections

Where the DNA of Anapagurus chiroacanthus was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found2

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 2 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Anapagurus chiroacanthus

At a glance

Sources6 archives

Habitat & environment2

At a glance

Record type1 800 records

Range

Depth

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions8 of 24 geolocated

Signal

Where its DNA was found

How strong is each trace?

Record type1 800 records