Anagrus daanei

Triapitsyn, 1998 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Hymenoptera/Mymaridae/Anagrus

At a glance

Occurrence records103

Data sources6

Biological traits0

DNA specimens2 976

eDNA detections2 977

Sources6 archives

Databases and archives Anagrus daanei's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility103 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI2 977 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics2 976 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF103 records

Environmental DNA3 datasets · 11 countries2 977 detections

DNA & barcodingBOLD2 976 specimens

01Narrative

Anagrus daanei is een vliesvleugelig insect uit de familie Mymaridae. De wetenschappelijke naam is voor het eerst geldig gepubliceerd in 1998 door Triapitsyn.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding2 976 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Anagrus daanei has left across the world's sequence archives.

At a glance

DNA specimens2 976

BINs2

Marker genes2

eDNA detections2 977

Countries12

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P647 bp consensus2 323 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 89% of positions are identical in every specimen.

Where individuals differ — all 74 variable positions, in barcode order

4Amostly conserved

19Avariable

22Avariable

26Gvariable

31Amostly conserved

40Tmostly conserved

46Tvariable

52Amostly conserved

64Amostly conserved

70Amostly conserved

76Tvariable

85Gvariable

86Gmostly conserved

88Amostly conserved

97Tmostly conserved

103Tmostly conserved

118Avariable

130Tmostly conserved

133Tmostly conserved

151Tmostly conserved

160Tvariable

175Amostly conserved

178Tmostly conserved

181Amostly conserved

187Avariable

199Tmostly conserved

202Tmostly conserved

205Amostly conserved

211Amostly conserved

220Tvariable

232Tmostly conserved

235Tvariable

271Amostly conserved

274Amostly conserved

279Tmostly conserved

280Amostly conserved

295Amostly conserved

298Amostly conserved

307Avariable

310Amostly conserved

313Tvariable

319Tmostly conserved

322Amostly conserved

331Avariable

340Tvariable

349Tmostly conserved

361Tmostly conserved

367Tmostly conserved

370Tvariable

388Tvariable

412Tvariable

415Amostly conserved

418Tmostly conserved

427Amostly conserved

433Amostly conserved

457Amostly conserved

475Amostly conserved

505Tvariable

508Amostly conserved

517Tmostly conserved

535Amostly conserved

538Tvariable

556Tmostly conserved

598Avariable

607Tmostly conserved

610Tvariable

613Tvariable

619Tmostly conserved

622Tmostly conserved

625Tvariable

628Tvariable

634Gvariable

637Tmostly conserved

643Tmostly conserved

TTTATATTTTATTTTTGGAATATGAGCTGGATTTTTAGGTTTATCTTTAAGAATAATAATTCGATTAGAATTAGGTAATCCTGGGGCATT …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens. Showing the 40 commonest of 527 variants.

Diversity (π)5.3%

Haplotypes527

BINs2

Most divergent pair24.0%

N.AmericaS.America

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Anagrus incarnatussame genus4.2%Anagrus arboridiaesame genus6.2%Anagrus ustulatussame genus6.5%Anagrus atomussame genus6.7%Anagrus avalaesame genus7.6%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P★ITS2

animal barcodefungal barcode

08Occurrence & distribution

Record type103 records

Wild obs. + sensor2

Museum / vouchered101

Range

Area of Occupancy AOO72 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy100% within 1 km

≤100 m 2

2 georeferenced

Open the mapobservation + sensor2

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy97% within 1 km

≤100 m 28≤10 km 1

29 georeferenced · 72 without coordinates

Open the institutions mapphysical evidence101

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions1 of 4 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Centre for Biodiversity Genomicslocation not on record	40
Université de Montréallocation not on record	28
Essig Museum of Entomologylocation not on record	5
Washington, US	1

4 institutions · 74 of 101 vouchered records shown · 27 without an institution code

09Environmental DNA2 977 detections

Where the DNA of Anagrus daanei was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found2 977

Studies independent surveys3

Countries11

Verifiable raw sequence linked9

Signal confidence: moderateweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 2 977 detections have coordinates

Open the map11 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median18.2 °C 11.8–23.4

Seasonal swing summer↔winter26.0 °C

Max temp (day)23.1 °C 15.4–26.9

Min temp (night)14.2 °C 7.70–20.2

Precipitation88.1 mm/mo 32.8–182

Air humidity59.6 % 55.2–67.6

Moisture balance-39.4 mm/mo -97.2–143

Vapour deficit822 Pa 510–1,086

Wind speed2.80 m/s 1.70–6.10

Cloud cover40.0 % 18.8–53.2

CHELSA 1981–2010, ~9 km grid, at location & month of 2 973 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)