Anagrus atomus

(Linnaeus, 1767) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Hymenoptera/Mymaridae/Anagrus

At a glance

Occurrence records61

Data sources6

Biological traits0

DNA specimens449

eDNA detections1 158

Sources6 archives

Databases and archives Anagrus atomus's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility61 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI1 158 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics449 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF61 records

Environmental DNA3 datasets · 21 countries1 158 detections

DNA & barcodingBOLD449 specimens

01Narrative

Anagrus atomus est une espèce d'insectes hyménoptères de la famille des Mymaridae, originaire de la région paléarctique. Il s'agit d'une petite guêpe qui parasite les œufs de cicadelles et qui est utilisée comme agent de lutte biologique. Elle est commercialisée dans la région OEPP où elle est utilisée depuis 1994, en particulier dans les cultures de tomates en serre, notamment en Allemagne, en Belgique, en France, en Espagne, aux Pays-Bas et au Royaume-Uni, dans les cultures sous serre, contre les cicadelles.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding449 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Anagrus atomus has left across the world's sequence archives.

At a glance

DNA specimens449

BINs5

Marker genes2

eDNA detections1 158

Countries21

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P646 bp consensus399 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 95% of positions are identical in every specimen.

Where individuals differ — all 30 variable positions, in barcode order

39Tmostly conserved

51Amostly conserved

102Tmostly conserved

123Gmostly conserved

129Tmostly conserved

237Amostly conserved

290Cmostly conserved

312Tmostly conserved

318Tmostly conserved

321Tmostly conserved

333Cvariable

339Tvariable

366Tmostly conserved

369Tmostly conserved

378Amostly conserved

387Amostly conserved

411Tmostly conserved

417Tmostly conserved

420Tmostly conserved

426Gmostly conserved

468Gmostly conserved

492Gmostly conserved

504Tvariable

531Amostly conserved

549Gmostly conserved

588Amostly conserved

597Tmostly conserved

624Tmostly conserved

627Tmostly conserved

636Tmostly conserved

TTATATTTTATTTTTGGTATATGAGCAGGTTTTTTAGGTTTATCATTAAGAATATTAATTCGTTTAGAATTAGGAAATCCTGGATCATTT …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens. Showing the 28 commonest of 64 variants.

Diversity (π)1.8%

Haplotypes64

BINs5

Most divergent pair14.4%

AsiaEuropeAfricaN.AmericaS.America

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Anagrus ustulatussame genus4.3%Anagrus daaneisame genus6.7%Anagrus arboridiaesame genus7.4%Anagrus flaviapexsame genus7.6%Anagrus incarnatussame genus8.0%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P★ITS2

animal barcodefungal barcode

08Occurrence & distribution

Record type61 records

Wild obs. + sensor6

Museum / vouchered55

Origin

Introduced2

Range

Area of Occupancy AOO92 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy50% within 1 km

≤100 m 2≤10 km 2

4 georeferenced · 2 without coordinates

Open the mapobservation + sensor6

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy87% within 1 km

≤100 m 12≤1 km 1≤10 km 2

15 georeferenced · 40 without coordinates

Open the institutions mapphysical evidence55

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions2 of 9 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
University of Guelph, Centre for Biodiversity Genomicslocation not on record	10
NTNU-VMlocation not on record	8
Université de Montréallocation not on record	4
Centre for Biodiversity Genomicslocation not on record	3
MWLRlocation not on record	2
Champaign, US	2
Helsinki, FI	1
Essig Museum of Entomologylocation not on record	1
Bavarian State Collection of Zoologylocation not on record	1

9 institutions · 32 of 55 vouchered records shown · 22 without an institution code

09Environmental DNA1 158 detections

Where the DNA of Anagrus atomus was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found1 158

Studies independent surveys3

Countries21

Verifiable raw sequence linked723

Signal confidence: moderateweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 1 158 detections have coordinates

Open the map21 countries0

8. Desert | 8.1. Hot Desert1. Forest & Woodland1. Forest & Woodland | 1.4. Temperate ForestUrban1. Forest & Woodland|1.4. Temperate Forest14. Artificial - Terrestrial|14.5 Urban Areas

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median14.4 °C 10.6–18.6

Seasonal swing summer↔winter17.5 °C

Max temp (day)18.2 °C 14.2–23.7

Min temp (night)10.7 °C 6.40–14.1

Precipitation64.8 mm/mo 5.50–108

Air humidity60.7 % 54.7–63.2

Moisture balance-43.6 mm/mo -93.2–48.1

Vapour deficit646 Pa 487–922

Wind speed3.60 m/s 2.20–4.50

Cloud cover41.6 % 23.5–53.2

CHELSA 1981–2010, ~9 km grid, at location & month of 1 121 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)