Anaceratagallia ribauti

(Ossiannilsson, 1938) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Hemiptera/Cicadellidae/Anaceratagallia

At a glance

Occurrence records1 514

Data sources5

Biological traits2

DNA specimens17

eDNA detections85

Sources5 archives

Databases and archives Anaceratagallia ribauti's data was compiled from.

GBIFGlobal Biodiversity Information Facility1 514 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI85 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics17 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

Traits & measurements1 literature sources2 traits

Occurrence & distributionGBIF1 514 records

Environmental DNA4 datasets · 7 countries85 detections

DNA & barcodingBOLD17 specimens

02Traits & measurements

SourcesPantheon

Diet & foraging2

Feeding guild (adult)herbivore

Feeding guild (larval)herbivore

05DNA & barcoding17 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Anaceratagallia ribauti has left across the world's sequence archives.

At a glance

DNA specimens17

BINs2

Marker genes1

eDNA detections85

Countries7

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P655 bp consensus17 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 95% of positions are identical in every specimen.

Diversity (π)2.2%

Haplotypes2

BINs2

Most divergent pair4.0%

Where individuals differ — all 33 variable positions, in barcode order

25Gvariable

97Avariable

109Tvariable

160Tvariable

194Tvariable

205Amostly conserved

229Gvariable

247Tvariable

271Tmostly conserved

291Tvariable

334Tvariable

344Tvariable

364Tvariable

379Avariable

382Tvariable

385Avariable

388Amostly conserved

445Tvariable

451Tvariable

478Avariable

487Cvariable

490Gvariable

505Amostly conserved

517Cvariable

530Cvariable

545Cmostly conserved

559Avariable

562Tmostly conserved

616Gvariable

622Gvariable

625Avariable

628Tmostly conserved

643Cmostly conserved

AATATACTTTATCTTTGGTATATGGTCAGCAATAGTAGGAATAATACTTAGAATAATTATCCGAATTGAACTGGCTCAACCAGGCTCAAT …

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Anaceratagallia venosasame genus12.8%Agallia constrictasame family16.2%Maiestas schmidtgenisame family17.6%Scaphoideus assamensissame family17.7%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type1 514 records

Wild obs. + sensor919

Museum / vouchered584

Cultivated / captive11

Range

Area of Occupancy AOO2 640 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy72% within 1 km

≤100 m 396≤1 km 133≤10 km 207

736 georeferenced · 183 without coordinates

Open the mapobservation + sensor919

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy99% within 1 km

≤100 m 531≤1 km 35≤10 km 5

571 georeferenced · 13 without coordinates

Open the institutions mapphysical evidence584

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy

no georeferenced coordinates · 11 records without

Open the mapnot free-living11

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions4 of 10 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
SLU Artdatabankenlocation not on record	48
Metsähallituslocation not on record	31
Natural History Museum Rotterdamlocation not on record	19
Champaign, US	19
Tilburg, NL	3
Tartu, EE	2
neflocation not on record	2
BioFokuslocation not on record	1
NHMOlocation not on record	1
University Park, US	1

10 institutions · 127 of 584 vouchered records shown · 457 without an institution code

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

09Environmental DNA85 detections

Where the DNA of Anaceratagallia ribauti was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found85

Studies independent surveys4

Countries7

Verifiable raw sequence linked44

Signal confidence: moderateweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 85 detections have coordinates

Open the map7 countries0

1.1. Boreal Forest|1. Forest & Woodland87UrbanHay meadow

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median16.2 °C 10.0–17.2

Seasonal swing summer↔winter18.3 °C

Max temp (day)20.1 °C 11.9–21.8

Min temp (night)11.5 °C 6.20–13.4

Precipitation72.2 mm/mo 50.2–95.8

Air humidity61.0 % 58.3–63.2

Moisture balance-26.5 mm/mo -51.0–27.7

Vapour deficit710 Pa 418–809

Wind speed2.60 m/s 2.00–4.20

Cloud cover44.1 % 40.2–54.7

CHELSA 1981–2010, ~9 km grid, at location & month of 80 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Anaceratagallia ribauti

At a glance

Sources5 archives

Diet & foraging2

At a glance

Record type1 514 records

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Cultivated / Captivenot free-living

Wildobservation + sensor

Holding institutions4 of 10 geolocated

Cultivated / Captivenot free-living

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type1 514 records