Amplypterus panopus

Cramer, 1779 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Sphingidae/Amplypterus

At a glance

Occurrence records558

Data sources7

Biological traits0

DNA specimens77

eDNA detections75

Sources7 archives

Databases and archives Amplypterus panopus's data was compiled from.

WikipediaWikimedia Foundation4 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility558 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI75 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics77 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF558 records

Environmental DNA1 datasets · 10 countries75 detections

DNA & barcodingBOLD77 specimens

01Narrative

Amplypterus panopus, the mango hawkmoth, is a moth of the family Sphingidae. The species was first described by Pieter Cramer in 1779. It is found in Sri Lanka, southern and northern India (including the Andaman Islands and Nicobar Islands), Nepal, Myanmar, southern China, Thailand, Vietnam, Laos, Indonesia (to Sulawesi) and the Philippines.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding77 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Amplypterus panopus has left across the world's sequence archives.

At a glance

DNA specimens77

BINs7

Marker genes2

eDNA detections75

Countries10

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus75 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 92% of positions are identical in every specimen.

Where individuals differ — all 54 variable positions, in barcode order

22Amostly conserved

40Tmostly conserved

59Tmostly conserved

76Amostly conserved

79Amostly conserved

82Cmostly conserved

85Cmostly conserved

103Tmostly conserved

121Tmostly conserved

151Tmostly conserved

157Tmostly conserved

169Tmostly conserved

205Tmostly conserved

206Tmostly conserved

217Avariable

220Cmostly conserved

226Cvariable

238Cvariable

250Cmostly conserved

271Cvariable

313Tvariable

316Tmostly conserved

319Amostly conserved

322Tmostly conserved

340Tmostly conserved

343Amostly conserved

346Tmostly conserved

347Tmostly conserved

352Tmostly conserved

364Tmostly conserved

382Tmostly conserved

394Cvariable

400Cvariable

401Tvariable

406Tmostly conserved

412Amostly conserved

433Gvariable

445Cvariable

472Tmostly conserved

478Cmostly conserved

484Cmostly conserved

508Amostly conserved

511Amostly conserved

517Amostly conserved

520Avariable

523Tmostly conserved

542Tmostly conserved

548Tmostly conserved

562Tmostly conserved

581Tmostly conserved

616Cmostly conserved

625Amostly conserved

628Gmostly conserved

652Tmostly conserved

AACATTATATTTTATTTTTGGAATTTGATCAGGAATAGTTGGAACTTCTTTAAGATTATTAATTCGAGCAGAATTAGGAAACCCCGGATC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)2.7%

Haplotypes28

BINs7

Most divergent pair7.3%

Asia

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Ambulyx mooreisame family7.1%Ambulyx rawlinsisame family7.1%Callambulyx kitchingisame family7.1%Adhemarius dentonisame family7.3%Coequosa australasiaesame family7.6%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-3P★COI-5P

animal barcode

Organelle genome

Besides the big genome in the nucleus, cells carry a small, circular loop of DNA inside the cell's energy factories — the mitochondria. It is inherited almost only from the mother and is a leftover from ancient bacteria that moved into the cell. The mitochondrial markers above (ND*, COX, CYTB…) are read from exactly this loop. Outer ring = one strand, inner ring = the other.

▸ Tap any coloured segment — or a gene chip — to see what it is

Mitochondrion

NC_046717 ↗ · 13 protein · 22 tRNA · 2 rRNA

ND2COX1COX2ATP8ATP6COX3ND3ND5ND4ND4LND6CYTBND116S ribosomal RNA12S ribosomal RNA

◖ violet arc = the COI-5P barcode — the ~650 bp read used to ID this species

Pick a coloured segment on the ring — or a gene chip — to read what that gene does.

protein-codingrRNAtRNA

08Occurrence & distribution

Record type558 records

Wild obs. + sensor509

Museum / vouchered49

Range

Area of Occupancy AOO1 316 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy74% within 1 km

≤100 m 194≤1 km 124≤10 km 52>10 km 61

431 georeferenced · 78 without coordinates

Open the mapobservation + sensor509

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy7% within 1 km

≤1 km 2≤10 km 15>10 km 12

29 georeferenced · 20 without coordinates

Open the institutions mapphysical evidence49

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions3 of 7 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Natural History Museum Rotterdamlocation not on record	19
Helsinki, FI	12
Auckland, NZ	10
Denver, US	2
Natural History Museum of Utahlocation not on record	2
Cleveland Museum of Natural History, OH (CLEV)location not on record	1
Centre for Biodiversity Genomicslocation not on record	1

7 institutions · 47 of 49 vouchered records shown · 2 without an institution code

09Environmental DNA75 detections

Where the DNA of Amplypterus panopus was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found75

Studies independent surveys1

Countries10

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 75 detections have coordinates

Open the map10 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median22.6 °C 17.1–25.6

Seasonal swing summer↔winter3.00 °C

Max temp (day)25.6 °C 20.4–29.2

Min temp (night)19.6 °C 14.2–23.3

Precipitation194 mm/mo 34.4–555

Air humidity67.6 % 62.5–73.5

Moisture balance60.5 mm/mo -61.2–428

Vapour deficit802 Pa 560–1,148

Wind speed2.10 m/s 1.20–6.40

Cloud cover45.9 % 24.7–67.9

CHELSA 1981–2010, ~9 km grid, at location & month of 62 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)