Ambulyx moorei

Moore · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Sphingidae/Ambulyx

At a glance

Occurrence records531

Data sources6

Biological traits0

DNA specimens75

eDNA detections77

Sources6 archives

Databases and archives Ambulyx moorei's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility531 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI77 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics75 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF531 records

Environmental DNA1 datasets · 6 countries77 detections

DNA & barcodingBOLD75 specimens

01Narrative

Ambulyx subocellata is een vlinder uit de familie van de pijlstaarten (Sphingidae). De wetenschappelijke naam van de soort is voor het eerst geldig gepubliceerd in 1874 door Felder.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding75 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Ambulyx moorei has left across the world's sequence archives.

At a glance

DNA specimens75

BINs1

Marker genes2

eDNA detections77

Countries9

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus61 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 98% of positions are identical in every specimen.

Where individuals differ — all 14 variable positions, in barcode order

22Amostly conserved

223Tvariable

235Cmostly conserved

328Amostly conserved

367Tmostly conserved

403Tvariable

412Amostly conserved

427Tvariable

508Avariable

538Amostly conserved

601Tvariable

625Amostly conserved

628Avariable

631Avariable

AACATTATATTTTATTTTTGGAATTTGATCAGGAATAGTAGGAACTTCTTTAAGATTACTTATTCGAGCAGAATTAGGAAACCCCGGATC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)1.0%

Haplotypes24

BIN1

Most divergent pair2.1%

AsiaOther

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Ambulyx celebensissame genus3.3%Ambulyx amboynensissame genus3.5%Ambulyx bakerisame genus3.5%Ambulyx semifervenssame genus3.6%Ambulyx rawlinsisame genus3.6%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-3P★COI-5P

animal barcode

08Occurrence & distribution

Record type531 records

Wild obs. + sensor489

Museum / vouchered42

Range

Area of Occupancy AOO1 032 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy72% within 1 km

≤100 m 168≤1 km 128≤10 km 63>10 km 51

410 georeferenced · 79 without coordinates

Open the mapobservation + sensor489

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy0% within 1 km

≤10 km 8>10 km 25

33 georeferenced · 9 without coordinates

Open the institutions mapphysical evidence42

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions4 of 6 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Auckland, NZ	24
Natural History Museum Rotterdamlocation not on record	8
South Kensington, GB	5
Helsinki, FI	2
New Haven, US	1
Research Collection of Michael Moosburglocation not on record	1

6 institutions · 41 of 42 vouchered records shown · 1 without an institution code

09Environmental DNA77 detections

Where the DNA of Ambulyx moorei was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found77

Studies independent surveys1

Countries6

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 77 detections have coordinates

Open the map6 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median24.4 °C 19.9–27.2

Seasonal swing summer↔winter1.50 °C

Max temp (day)27.2 °C 23.5–29.8

Min temp (night)20.0 °C 16.2–26.2

Precipitation268 mm/mo 70.6–411

Air humidity68.1 % 62.9–71.1

Moisture balance141 mm/mo -13.6–590

Vapour deficit847 Pa 669–1,320

Wind speed1.70 m/s 1.10–4.60

Cloud cover61.9 % 23.3–74.3

CHELSA 1981–2010, ~9 km grid, at location & month of 49 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)