Amphioctopus kagoshimensis

(Ortmann, 1888) · species

image placeholder — illustration coming later

Animalia/Mollusca/Cephalopoda/Octopoda/Octopodidae/Amphioctopus

At a glance

Occurrence records45

Data sources8

Biological traits2

DNA specimens30

eDNA detections30

Sources8 archives

Databases and archives Amphioctopus kagoshimensis's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility41 records↗

OBISOcean Biodiversity Information System4 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI30 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics30 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

WikidataWikimedia Foundationstructured facts↗

Catalogue of LifeCOLtaxonomy↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources2 traits

Occurrence & distributionGBIF · OBIS45 records

Environmental DNA1 datasets · 3 countries30 detections

DNA & barcodingBOLD30 specimens

01Narrative

Amphioctopus kagoshimensis is een inktvissensoort uit de familie van de Octopodidae. De wetenschappelijke naam van de soort werd voor het eerst geldig gepubliceerd in 1888 door Ortmann als Octopus kagoshimensis.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesSeaLifeBase

Habitat & environment2

Habitat saltwateryes

Habitat zonebenthic

05DNA & barcoding30 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Amphioctopus kagoshimensis has left across the world's sequence archives.

At a glance

DNA specimens30

BINs2

Marker genes1

eDNA detections30

Countries4

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P638 bp consensus29 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 99% of positions are identical in every specimen.

Where individuals differ — all 7 variable positions, in barcode order

144Cmostly conserved

219Tmostly conserved

249Gvariable

258Tmostly conserved

477Gvariable

480Tmostly conserved

621Cmostly conserved

GGAATCTGATCAGGCCTATTAGGTACCTCATTAAGTTTAATAATTCGAACAGAATTAGGACAACCAGGATCCTTACTTAATGATGATCAA …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)1.0%

Haplotypes5

BINs2

Most divergent pair10.8%

AsiaOtherOceania

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Amphioctopus aeginasame genus10.3%Amphioctopus membranaceussame genus10.6%Hapalochlaena maculosasame family11.8%Amphioctopus marginatussame genus11.9%Amphioctopus burryisame genus12.1%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type45 records

Wild obs. + sensor20

Museum / vouchered25

Range

Area of Occupancy AOO92 km²

Depth

0–200 m sunlit2

200–1000 m twilight0

1–4 km midnight0

>4 km abyssal0

median 63.6 m · max 86.5 m · 2 records with depth

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy67% within 1 km

≤100 m 4≤1 km 6≤10 km 2>10 km 3

15 georeferenced · 5 without coordinates

Open the mapobservation + sensor20

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy

no georeferenced coordinates · 25 records without

Open the institutions mapphysical evidence25

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions1 of 3 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Sydney, AU	14
Museums Victorialocation not on record	8
Earth Sciences New Zealandlocation not on record	1

3 institutions · 23 of 25 vouchered records shown · 1 without an institution code

09Environmental DNA30 detections

Where the DNA of Amphioctopus kagoshimensis was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found30

Studies independent surveys1

Countries3

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 30 detections have coordinates

Open the map3 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median17.2 °C 9.40–17.4

Seasonal swing summer↔winter7.60 °C

Max temp (day)17.9 °C 11.2–18.7

Min temp (night)15.8 °C 5.60–16.5

Precipitation71.0 mm/mo 68.7–290

Air humidity58.4 % 56.6–63.6

Moisture balance263 mm/mo

Vapour deficit816 Pa 506–860

Wind speed3.20 m/s

Cloud cover38.2 % 25.9–43.3

CHELSA 1981–2010, ~9 km grid, at location & month of 3 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)