Amphioctopus burryi

(G.L.Voss, 1950) · species

image placeholder — illustration coming later

Animalia/Mollusca/Cephalopoda/Octopoda/Octopodidae/Amphioctopus

At a glance

Occurrence records170

Data sources10

Biological traits6

DNA specimens12

eDNA detections4

Sources10 archives

Databases and archives Amphioctopus burryi's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility110 records↗

OBISOcean Biodiversity Information System60 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI4 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics12 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GoaTGenomes on a Tree · Sangergenome & karyotype↗

NCBIUS National Library of Medicinegenome & karyotype↗

WikidataWikimedia Foundationstructured facts↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources6 traits

Occurrence & distributionGBIF · OBIS170 records

Environmental DNA1 datasets · 0 countries4 detections

DNA & barcodingBOLD12 specimens

Genome at a glanceGoaT · NCBI≈1 Gbp

01Narrative

Amphioctopus burryi is een inktvissensoort uit de familie van de Octopodidae. De wetenschappelijke naam van de soort werd voor het eerst geldig gepubliceerd in 1950 door Voss.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesSeaLifeBase

Size & morphology1

Body length7 cm

Habitat & environment2

Habitat saltwateryes

Habitat zonebenthic

Uses & economy1

Commercial importancebycatch

Other traits2

Depth max200 m

Depth min0 m

05DNA & barcoding12 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Amphioctopus burryi has left across the world's sequence archives.

At a glance

DNA specimens12

BINs1

Marker genes2

eDNA detections4

Countries4

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P639 bp consensus11 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 98% of positions are identical in every specimen.

Where individuals differ — all 13 variable positions, in barcode order

4Gmostly conserved

6Amostly conserved

45Amostly conserved

327Tmostly conserved

420Gmostly conserved

453Amostly conserved

477Gmostly conserved

483Gmostly conserved

526Cmostly conserved

564Tmostly conserved

576Amostly conserved

627Cmostly conserved

636Tmostly conserved

TTTGGAATTTGATCAGGCCTCCTAGGAACTTCATTAAGTTTAATAATTCGAACAGAACTAGGGCAACCAGGATCTCTATTAAATGATGAT …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.42%

Haplotypes5

BIN1

Most divergent pair0.94%

N.AmericaOther

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Amphioctopus marginatussame genus5.2%Amphioctopus membranaceussame genus8.5%Amphioctopus aeginasame genus9.8%Amphioctopus rexsame genus10.6%Amphioctopus neglectussame genus10.7%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-3P★COI-5P

animal barcode

06Genome at a glanceGoaT · NCBI

The complete instruction manual Amphioctopus burryi carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Genome sizehow big the whole instruction manual is

Genome size≈1 031 232 840 bp assembly estimate

Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).

BACTERIUM Carsonella ruddii0.00016 Gb

FUNGUS0.04 Gb

INSECT0.25 Gb

THIS GENOME Amphioctopus burryi1.03 Gb

HUMAN3.2 Gb

WHEAT17 Gb

FERN Tmesipteris160.45 Gb

Sequencing statusassembly quality — how far to trust these numbers

Assembly level tells you how finished the sequence is — from fragmented contigs, through scaffolds, up to a full chromosome-level assembly. BUSCO % estimates completeness: the share of genes expected to be present that were actually found. These describe the data quality, not the organism.

Assembly levelScaffold

08Occurrence & distribution

Record type170 records

Wild obs. + sensor86

Museum / vouchered84

Range

Area of Occupancy AOO408 km²

Depth

0–200 m sunlit35

200–1000 m twilight0

1–4 km midnight0

>4 km abyssal0

median 64 m · max 178 m · 35 records with depth

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy72% within 1 km

≤100 m 19≤1 km 23≤10 km 7>10 km 9

58 georeferenced · 28 without coordinates

Open the mapobservation + sensor86

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy38% within 1 km

≤1 km 3≤10 km 4>10 km 1

8 georeferenced · 76 without coordinates

Open the institutions mapphysical evidence84

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions2 of 6 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
UM-RSMASlocation not on record	19
Paris, FR	10
Museu Nacional de História Natural e da Ciêncialocation not on record	2
Alabama Museum of Natural Historylocation not on record	1
Philadelphia, US	1
Delaware Museum of Nature and Sciencelocation not on record	1

6 institutions · 34 of 84 vouchered records shown · 16 without an institution code

09Environmental DNA4 detections

Where the DNA of Amphioctopus burryi was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found4

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 4 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)