Amphilophus astorquii — The Life Data

Animalia/Chordata/Perciformes/Cichlidae/Amphilophus

At a glance

Occurrence records7

Data sources6

Biological traits4

DNA specimens3

eDNA detections0

Sources6 archives

Databases and archives Amphilophus astorquii's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility7 records↗

BOLD SystemsCentre for Biodiversity Genomics3 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

WikidataWikimedia Foundationstructured facts↗

Catalogue of LifeCOLtaxonomy↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources4 traits

Occurrence & distributionGBIF7 records

DNA & barcodingBOLD3 specimens

01Narrative

Amphilophus astorquii is een straalvinnige vissensoort uit de familie van de cichliden (Cichlidae). De wetenschappelijke naam van de soort is voor het eerst geldig gepubliceerd in 2008 door Stauffer, McCrary & Black.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesFishBase

Size & morphology1

Body length15.46 cm

Habitat & environment2

Habitat freshwateryes

Habitat zonebenthopelagic

Other traits1

Vulnerability10

05DNA & barcoding3 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Amphilophus astorquii has left across the world's sequence archives.

At a glance

DNA specimens3

BINs1

Marker genes1

Countries1

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P652 bp consensus3 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 100% of positions are identical in every specimen.

Diversity (π)0.26%

Haplotypes2

BIN1

Most divergent pair0.31%

Where individuals differ — all 2 variable positions, in barcode order

8Avariable

24Gvariable

CCTTTACATAATTTTTGGTGCTTGGGCCGGAATGGTAGGCACCGCATTAAGCCTATTAATCCGAGCAGAACTCAGCCAACCAGGCTCTCT …

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Parachromis loiselleisame family5.0%Parachromis friedrichsthaliisame family5.8%Parachromis managuensissame family6.0%Parachromis doviisame family6.0%Amatitlania septemfasciatasame family6.2%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

COI-5P

animal barcode

08Occurrence & distribution

Record type7 records

Wild obs. + sensor6

Museum / vouchered1

Range

Area of Occupancy AOO28 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy0% within 1 km

>10 km 6

6 georeferenced

Open the mapobservation + sensor6

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy

no georeferenced coordinates · 1 records without

Open the institutions mapphysical evidence1

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.