Amphicerus bicaudatus

(Say, 1824) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Coleoptera/Bostrichidae/Amphicerus

At a glance

Occurrence records385

Data sources5

Biological traits0

DNA specimens4

eDNA detections4

Sources5 archives

Databases and archives Amphicerus bicaudatus's data was compiled from.

WikipediaWikimedia Foundation1 languages↗

GBIFGlobal Biodiversity Information Facility385 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI4 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics4 specimens↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF385 records

Environmental DNA1 datasets · 2 countries4 detections

DNA & barcodingBOLD4 specimens

01Narrative

Amphicerus bicaudatus, known generally as the apple twig borer or grape cane borer, is a species of horned powder-post beetle in the family Bostrichidae. Apple twig borer, Amphicerus bicaudatus

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding4 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Amphicerus bicaudatus has left across the world's sequence archives.

At a glance

DNA specimens4

BINs1

Marker genes1

eDNA detections4

Countries2

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus3 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 99% of positions are identical in every specimen.

Diversity (π)0.61%

Haplotypes2

BIN1

Most divergent pair0.46%

Where individuals differ — all 6 variable positions, in barcode order

1Avariable

43Cvariable

94Gvariable

415Tvariable

445Cvariable

529Gvariable

AACTTTATACTTCATCTTTGGGGCATGAGCAGGTATAATTGGCACCTCTCTTAGAATCCTTATTCGATCAGAGCTTGGAACCCCAAGAGC …

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Amphicerus cornutussame genus15.9%Amphicerus anobioidessame genus17.1%Apatides fortissame family17.6%Sinoxylon analesame family17.7%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type385 records

Wild obs. + sensor102

Museum / vouchered283

Range

Area of Occupancy AOO612 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy87% within 1 km

≤100 m 54≤1 km 19>10 km 11

84 georeferenced · 18 without coordinates

Open the mapobservation + sensor102

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy11% within 1 km

≤100 m 11≤1 km 16≤10 km 143>10 km 68

238 georeferenced · 45 without coordinates

Open the institutions mapphysical evidence283

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions10 of 17 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Lubbock, US	105
University Park, US	53
East Lansing, US	45
Wuzhou, CN	39
Lexington, US	9
Albuquerque, US	8
MAJClocation not on record	6
San Luis Potosí, MX	4
US	4
Universidad Católica de Manizaleslocation not on record	2
University of Nebraska State Museumlocation not on record	2
OSUClocation not on record	1
Cambridge, US	1
CUlocation not on record	1
Canadian National Collection of Insects, Arachnids and Nematodeslocation not on record	1
Ciudad de México, MX	1
Royal Saskatchewan Museumlocation not on record	1

17 institutions · 283 of 283 vouchered records shown

09Environmental DNA4 detections

Where the DNA of Amphicerus bicaudatus was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found4

Studies independent surveys1

Countries2

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 4 detections have coordinates

Open the map2 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median16.9 °C 13.6–20.1

Seasonal swing summer↔winter25.4 °C

Max temp (day)20.8 °C 17.8–24.5

Min temp (night)13.7 °C 9.90–16.9

Precipitation88.7 mm/mo 77.6–123

Air humidity58.5 % 55.9–60.1

Moisture balance-49.5 mm/mo -69.9–-3.00

Vapour deficit812 Pa 657–978

Wind speed3.90 m/s 3.00–6.20

Cloud cover42.5 % 38.4–46.0

CHELSA 1981–2010, ~9 km grid, at location & month of 4 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)