Sinoxylon anale

Lesne, 1897 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Coleoptera/Bostrichidae/Sinoxylon

At a glance

Occurrence records210

Data sources8

Biological traits0

DNA specimens12

eDNA detections24

Sources8 archives

Databases and archives Sinoxylon anale's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility210 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI24 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics12 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GoaTGenomes on a Tree · Sangergenome & karyotype↗

Tree of SexTree of Sex Consortiumgenome & karyotype↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF210 records

Environmental DNA2 datasets · 5 countries24 detections

DNA & barcodingBOLD12 specimens

Genome at a glanceGoaT · TreeOfSex2n = 20

01Narrative

Sinoxylon anale is a species of horned powder-post beetle in the family Bostrichidae. It is found in Australia, North America, Southern Asia, and Europe.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding12 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Sinoxylon anale has left across the world's sequence archives.

At a glance

DNA specimens12

BINs3

Marker genes2

eDNA detections24

Countries5

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P615 bp consensus9 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 82% of positions are identical in every specimen.

Where individuals differ — all 112 variable positions, in barcode order

3Amostly conserved

6Avariable

9Amostly conserved

18Avariable

21Tvariable

24Cvariable

33Avariable

39Avariable

42Tvariable

45Amostly conserved

48Amostly conserved

51Amostly conserved

60Tmostly conserved

63Cvariable

69Cmostly conserved

72Cmostly conserved

75Cmostly conserved

78Avariable

81Tvariable

90Cmostly conserved

93Cmostly conserved

96Cmostly conserved

102Cvariable

108Tvariable

114Cvariable

123Avariable

126Tvariable

135Tmostly conserved

138Amostly conserved

144Cvariable

147Avariable

154Tmostly conserved

162Tmostly conserved

165Cvariable

177Cvariable

183Tmostly conserved

201Amostly conserved

204Cmostly conserved

222Tmostly conserved

225Tmostly conserved

228Cmostly conserved

231Tvariable

237Amostly conserved

240Tvariable

250Gmostly conserved

264Tvariable

276Amostly conserved

285Avariable

297Cvariable

303Tvariable

306Amostly conserved

309Tmostly conserved

310Amostly conserved

315Cmostly conserved

324Tvariable

327Amostly conserved

330Gvariable

339Tmostly conserved

342Cmostly conserved

343Cmostly conserved

348Amostly conserved

357Cvariable

364Tmostly conserved

366Amostly conserved

378Amostly conserved

385Cmostly conserved

393Cvariable

396Avariable

402Cmostly conserved

405Tmostly conserved

408Cmostly conserved

411Amostly conserved

414Tvariable

417Tvariable

420Tmostly conserved

426Amostly conserved

429Amostly conserved

430Avariable

435Avariable

441Tmostly conserved

447Tmostly conserved

450Amostly conserved

453Avariable

456Tvariable

457Cvariable

462Tmostly conserved

465Amostly conserved

471Avariable

477Cvariable

486Tvariable

489Tvariable

492Tmostly conserved

496Tmostly conserved

498Amostly conserved

501Cvariable

505Tmostly conserved

507Amostly conserved

514Cmostly conserved

516Tmostly conserved

519Amostly conserved

528Cmostly conserved

531Tvariable

537Tmostly conserved

543Tmostly conserved

552Cvariable

558Cmostly conserved

561Cmostly conserved

564Cvariable

579Amostly conserved

582Avariable

594Amostly conserved

609Cmostly conserved

ACATCACTAAGAATACTAATTCGCTCAGAACTAGGAACACCTAGAGCACTAATTGGAGATGACCAAATCTACAACGTAATTGTAACCGCC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)6.9%

Haplotypes3

BINs3

Most divergent pair15.8%

Asia

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Sinoxylon perforanssame genus14.5%Sinoxylon sudanicumsame genus14.6%Dicrepidius corvinussame order17.2%Episernus trapezoideussame order17.7%Lyctus cavicollissame family17.9%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-3P★COI-5P

animal barcode

06Genome at a glanceGoaT · TreeOfSex

The complete instruction manual Sinoxylon anale carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 20 n = 10

Chromosome records20–202n range20median20mode4records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 204×GoaT · Animal Chromosome Counts Database · GoaT · Tree of Sex Database · TreeOfSex · invert

GoaT · Animal Chromosome Counts Database — ↗

GoaT · Tree of Sex Database — ↗

TreeOfSex · invert — Smith SG, Virkki N (1978) Animal Cytogenetics Vol. 3 Insecta 5 Coleoptera. Berlin: Gebruder Borntraeger. ↗

08Occurrence & distribution

Record type210 records

Wild obs. + sensor19

Museum / vouchered191

Range

Area of Occupancy AOO276 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy67% within 1 km

≤100 m 7≤1 km 3≤10 km 1>10 km 4

15 georeferenced · 4 without coordinates

Open the mapobservation + sensor19

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy23% within 1 km

≤100 m 1≤1 km 33≤10 km 111>10 km 2

147 georeferenced · 44 without coordinates

Open the institutions mapphysical evidence191

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions5 of 8 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Ciudad de México, MX	98
Australian National Fish Collectionlocation not on record	46
Natick, US	13
Museums Victorialocation not on record	8
Sydney, AU	8
DPIlocation not on record	7
Paris, FR	1
Trondheim, NO	1

8 institutions · 182 of 191 vouchered records shown · 9 without an institution code

09Environmental DNA24 detections

Where the DNA of Sinoxylon anale was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found24

Studies independent surveys2

Countries5

Verifiable raw sequence linked11

Signal confidence: moderateweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 24 detections have coordinates

Open the map5 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median25.7 °C 20.2–27.0

Seasonal swing summer↔winter4.40 °C

Max temp (day)29.6 °C 25.0–31.6

Min temp (night)20.6 °C 14.8–22.4

Precipitation82.3 mm/mo 1.70–403

Air humidity56.3 % 52.0–69.6

Moisture balance-69.4 mm/mo -121–265

Vapour deficit1,338 Pa 1,004–1,577

Wind speed1.90 m/s 0.6–2.50

Cloud cover24.6 % 12.8–66.0

CHELSA 1981–2010, ~9 km grid, at location & month of 21 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)