Amphibalanus reticulatus

(Utinomi, 1967) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Maxillopoda/Sessilia/Balanidae/Amphibalanus

At a glance

Occurrence records2 019

Data sources5

Biological traits2

DNA specimens68

eDNA detections92

Sources5 archives

Databases and archives Amphibalanus reticulatus's data was compiled from.

GBIFGlobal Biodiversity Information Facility385 records↗

OBISOcean Biodiversity Information System1 634 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI92 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics68 specimens↗

Catalogue of LifeCOLtaxonomy↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

Traits & measurements1 literature sources2 traits

Occurrence & distributionGBIF · OBIS2 019 records

Environmental DNA1 datasets · 4 countries92 detections

DNA & barcodingBOLD68 specimens

02Traits & measurements

SourcesSeaLifeBase

Habitat & environment2

Habitat saltwateryes

Habitat zonesessile

05DNA & barcoding68 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Amphibalanus reticulatus has left across the world's sequence archives.

At a glance

DNA specimens68

BINs3

Marker genes1

eDNA detections92

Countries6

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P642 bp consensus68 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 89% of positions are identical in every specimen.

Where individuals differ — all 73 variable positions, in barcode order

21Amostly conserved

30Avariable

45Amostly conserved

46Cmostly conserved

57Cmostly conserved

61Cmostly conserved

66Amostly conserved

72Tmostly conserved

75Avariable

79Cvariable

93Tmostly conserved

99Cmostly conserved

102Cmostly conserved

108Tmostly conserved

123Cmostly conserved

141Cmostly conserved

159Cmostly conserved

177Amostly conserved

187Tmostly conserved

189Amostly conserved

204Amostly conserved

210Tmostly conserved

216Gmostly conserved

219Cmostly conserved

240Amostly conserved

252Tmostly conserved

258Amostly conserved

261Amostly conserved

288Cmostly conserved

289Cmostly conserved

291Tmostly conserved

294Amostly conserved

303Avariable

309Gmostly conserved

327Cmostly conserved

334Tmostly conserved

339Gvariable

345Cmostly conserved

357Tmostly conserved

360Amostly conserved

373Cvariable

378Amostly conserved

387Amostly conserved

399Tmostly conserved

402Gmostly conserved

426Cmostly conserved

441Amostly conserved

444Tmostly conserved

465Amostly conserved

466Cmostly conserved

468Tmostly conserved

477Tmostly conserved

483Tmostly conserved

486Tmostly conserved

504Tmostly conserved

513Amostly conserved

531Tmostly conserved

534Cmostly conserved

540Amostly conserved

549Cmostly conserved

552Amostly conserved

565Tmostly conserved

567Amostly conserved

568Tmostly conserved

583Tmostly conserved

597Tmostly conserved

603Tmostly conserved

609Tmostly conserved

621Tvariable

633Cmostly conserved

639Cmostly conserved

640Cmostly conserved

642Gvariable

ATTTTTGGAGCTTGATCAGCAATAGTTGGAACAGCTCTTAGAATACTAATTCGAGCCGAACTAGGACAACCTGGAAGACTAATTGGAGAT …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)2.8%

Haplotypes21

BINs3

Most divergent pair15.0%

AsiaOtherOceaniaN.America

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Amphibalanus variegatussame genus12.1%Megabalanus azoricussame family12.8%Nobia orbicellaesame order13.2%Epopella plicatasame order14.6%Paralucilia paraensissame order17.8%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

Organelle genome

Besides the big genome in the nucleus, cells carry a small, circular loop of DNA inside the cell's energy factories — the mitochondria. It is inherited almost only from the mother and is a leftover from ancient bacteria that moved into the cell. The mitochondrial markers above (ND*, COX, CYTB…) are read from exactly this loop. Outer ring = one strand, inner ring = the other.

▸ Tap any coloured segment — or a gene chip — to see what it is

Mitochondrion

NC_071896 ↗ · 13 protein · 22 tRNA · 2 rRNA

COX1COX2ATP8ATP6COX3ND3ND5ND4ND4LND6CYTBND1ND2rrnLrrnS

◖ violet arc = the COI-5P barcode — the ~650 bp read used to ID this species

Pick a coloured segment on the ring — or a gene chip — to read what that gene does.

protein-codingrRNAtRNA

08Occurrence & distribution

Record type2 019 records

Wild obs. + sensor163

Museum / vouchered1 849

Fossil1

Other6

Range

Area of Occupancy AOO964 km²

Depth

0–200 m sunlit21

200–1000 m twilight0

1–4 km midnight0

>4 km abyssal0

median 3 m · max 65.1 m · 21 records with depth

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy93% within 1 km

≤100 m 42≤1 km 15≤10 km 2>10 km 2

61 georeferenced · 102 without coordinates

Open the mapobservation + sensor163

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy81% within 1 km

≤100 m 12≤1 km 66≤10 km 7>10 km 11

96 georeferenced · 1 753 without coordinates

Open the institutions mapphysical evidence1 849

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions6 of 13 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
National Marine Biodiversity Institute of Korealocation not on record	104
Natick, US	55
Honolulu, US	44
Western Australian Museumlocation not on record	32
Florida Museum of Natural History- Zoology, Paleontology & Paleobotanylocation not on record	15
CASlocation not on record	13
Washington, US	8
Museu Nacional/Universidade Federal do Rio de Janeirolocation not on record	6
Museum and Art Gallery of the Northern Territorylocation not on record	3
Auckland, NZ	3
San Nicolás de los Garza, MX	2
Paris, FR	1
IPMAlocation not on record	1

13 institutions · 287 of 1 849 vouchered records shown · 3 without an institution code

09Environmental DNA92 detections

Where the DNA of Amphibalanus reticulatus was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found92

Studies independent surveys1

Countries4

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 92 detections have coordinates

Open the map4 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median12.5 °C 12.5–27.0

Seasonal swing summer↔winter27.0 °C

Max temp (day)18.4 °C 18.4–27.7

Min temp (night)8.20 °C 8.20–26.1

Precipitation79.6 mm/mo 79.6–202

Air humidity57.3 % 57.3–63.2

Moisture balance-38.4 mm/mo -38.4–-3.80

Vapour deficit733 Pa 733–1,307

Wind speed5.80 m/s 5.30–5.80

Cloud cover36.7 % 25.2–36.7

CHELSA 1981–2010, ~9 km grid, at location & month of 21 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Amphibalanus reticulatus

At a glance

Sources5 archives

Habitat & environment2

At a glance

Record type2 019 records

Range

Depth

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions6 of 13 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type2 019 records