Amphibalanus variegatus

(Darwin, 1854) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Maxillopoda/Sessilia/Balanidae/Amphibalanus

At a glance

Occurrence records787

Data sources7

Biological traits2

DNA specimens13

eDNA detections13

Sources7 archives

Databases and archives Amphibalanus variegatus's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility393 records↗

OBISOcean Biodiversity Information System394 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI13 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics13 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

Catalogue of LifeCOLtaxonomy↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources2 traits

Occurrence & distributionGBIF · OBIS787 records

Environmental DNA1 datasets · 0 countries13 detections

DNA & barcodingBOLD13 specimens

01Narrative

Amphibalanus variegatus is een zeepokkensoort uit de familie van de Balanidae. De wetenschappelijke naam van de soort is voor het eerst geldig gepubliceerd in 1854 door Darwin.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesSeaLifeBase

Habitat & environment2

Habitat saltwateryes

Habitat zonesessile

05DNA & barcoding13 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Amphibalanus variegatus has left across the world's sequence archives.

At a glance

DNA specimens13

BINs1

Marker genes1

eDNA detections13

Countries1

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P641 bp consensus13 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 79% of positions are identical in every specimen.

Where individuals differ — all 135 variable positions, in barcode order

8Tmostly conserved

14Amostly conserved

17Amostly conserved

20Amostly conserved

23Tmostly conserved

26Gvariable

33Tmostly conserved

35Amostly conserved

39Amostly conserved

41Amostly conserved

50Amostly conserved

53Tmostly conserved

62Tmostly conserved

68Tmostly conserved

71Amostly conserved

80Tmostly conserved

89Cmostly conserved

95Tmostly conserved

98Tmostly conserved

110Tmostly conserved

116Amostly conserved

119Cmostly conserved

137Tmostly conserved

140Tmostly conserved

152Amostly conserved

155Tmostly conserved

164Tmostly conserved

167Tmostly conserved

170Tmostly conserved

176Tmostly conserved

179Amostly conserved

185Tmostly conserved

189Tmostly conserved

191Amostly conserved

194Amostly conserved

195Tvariable

209Tmostly conserved

212Amostly conserved

215Tmostly conserved

221Tmostly conserved

225Cmostly conserved

227Tmostly conserved

230Tmostly conserved

233Cmostly conserved

242Tmostly conserved

248Tmostly conserved

251Amostly conserved

254Tvariable

257Amostly conserved

260Cmostly conserved

261Tmostly conserved

263Amostly conserved

267Tmostly conserved

269Amostly conserved

272Amostly conserved

281Amostly conserved

285Tmostly conserved

296Amostly conserved

299Amostly conserved

305Gmostly conserved

317Amostly conserved

320Gmostly conserved

326Amostly conserved

329Tmostly conserved

330Tmostly conserved

332Amostly conserved

338Amostly conserved

344Tmostly conserved

347Tmostly conserved

353Tmostly conserved

362Tmostly conserved

377Tmostly conserved

380Cvariable

384Tmostly conserved

386Amostly conserved

389Tmostly conserved

390Tmostly conserved

395Amostly conserved

398Amostly conserved

404Cmostly conserved

407Amostly conserved

413Amostly conserved

416Amostly conserved

419Tmostly conserved

422Tmostly conserved

437Tmostly conserved

440Amostly conserved

442Tmostly conserved

446Tmostly conserved

455Tmostly conserved

461Cmostly conserved

462Tmostly conserved

467Amostly conserved

476Amostly conserved

477Cmostly conserved

479Amostly conserved

482Tmostly conserved

488Tmostly conserved

491Amostly conserved

497Tmostly conserved

500Amostly conserved

503Tvariable

512Avariable

516Tmostly conserved

518Amostly conserved

519Tmostly conserved

521Amostly conserved

522Tmostly conserved

524Amostly conserved

527Amostly conserved

530Cmostly conserved

531Tmostly conserved

540Tmostly conserved

554Tmostly conserved

557Tmostly conserved

564Cmostly conserved

566Tmostly conserved

572Tmostly conserved

578Tmostly conserved

579Tmostly conserved

+15 more variable positions not shown

TTGGAGCTTGATCAGCAATAGTTGGGACAGCTTTAAGAATACTTATTCGAGCTGAATTAGGTCAACCTGGAAGATTAATTGGAGATGACC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)4.0%

Haplotypes3

BIN1

Most divergent pair0.78%

Asia

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Acasta turriformissame family10.5%Amphibalanus rhizophoraesame genus11.3%Acasta cyathussame family11.4%Darwiniella conjugatumsame order12.1%Cantellius hoegisame order12.1%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type787 records

Wild obs. + sensor32

Museum / vouchered747

Other8

Range

Area of Occupancy AOO740 km²

Depth

0–200 m sunlit22

200–1000 m twilight0

1–4 km midnight0

>4 km abyssal0

median 23.7 m · max 155.4 m · 22 records with depth

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy73% within 1 km

≤100 m 4≤1 km 4≤10 km 2>10 km 1

11 georeferenced · 21 without coordinates

Open the mapobservation + sensor32

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy71% within 1 km

≤100 m 222≤1 km 54≤10 km 101>10 km 14

391 georeferenced · 356 without coordinates

Open the institutions mapphysical evidence747

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions6 of 14 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Sydney, AU	135
QVMAGlocation not on record	69
Western Australian Museumlocation not on record	64
Museums Victorialocation not on record	39
CASlocation not on record	18
Tasmanian Museum & Art Gallerylocation not on record	13
DOI/NPS, Salem Maritime National Historic Sitelocation not on record	12
Auckland, NZ	8
Stockholm, SE	5
Washington, US	4
Natick, US	3
Earth Sciences New Zealandlocation not on record	1
Paris, FR	1
IPMAlocation not on record	1

14 institutions · 373 of 747 vouchered records shown

09Environmental DNA13 detections

Where the DNA of Amphibalanus variegatus was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found13

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 13 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)