Amphibalanus eburneus

(Gould, 1841) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Maxillopoda/Sessilia/Balanidae/Amphibalanus

At a glance

Occurrence records1 405

Data sources9

Biological traits3

DNA specimens73

eDNA detections73

Sources9 archives

Databases and archives Amphibalanus eburneus's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility767 records↗

OBISOcean Biodiversity Information System638 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI73 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics73 specimens↗

GoaTGenomes on a Tree · Sangergenome ~1.23 Gbp↗

Catalogue of LifeCOLtaxonomy↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources3 traits

Occurrence & distributionGBIF · OBIS1 405 records

Environmental DNA2 datasets · 4 countries73 detections

DNA & barcodingBOLD73 specimens

Genome at a glanceGoaT1.2 Gbp

01Narrative

Amphibalanus eburneus, the ivory barnacle, American acorn barnacle, is a species of acorn barnacle in the family Balanidae. It occurs on the east coast of North America, the Caribbean Sea and Gulf of Mexico.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesSeaLifeBase

Size & morphology1

Body length3 cm

Habitat & environment2

Habitat saltwateryes

Habitat zonesessile

05DNA & barcoding73 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Amphibalanus eburneus has left across the world's sequence archives.

At a glance

DNA specimens73

BINs2

Marker genes1

eDNA detections73

Countries4

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus66 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 96% of positions are identical in every specimen.

Where individuals differ — all 24 variable positions, in barcode order

21Gmostly conserved

43Amostly conserved

79Avariable

82Avariable

103Tvariable

112Cmostly conserved

118Tvariable

121Amostly conserved

127Tvariable

187Cvariable

196Gmostly conserved

217Avariable

229Gmostly conserved

271Gvariable

349Gvariable

388Cmostly conserved

406Tvariable

415Amostly conserved

496Avariable

517Cvariable

533Cvariable

556Avariable

589Cvariable

646Cmostly conserved

AACTCTATATTTAATTTTTGGAGCTTGATCCGCAATAGTAGGAACAGCTTTAAGAATACTAATTCGAGCTGAATTAGGACAACCAGGAAG …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)1.8%

Haplotypes26

BIN1

Most divergent pair3.3%

N.AmericaOther

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Amphibalanus improvisussame genus10.4%Cantellius pallidussame order13.9%Cantellius sextussame order13.9%Amphibalanus variegatussame genus14.0%Octolasmis hoekisame order15.2%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

06Genome at a glanceGoaT

The complete instruction manual Amphibalanus eburneus carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Genome sizehow big the whole instruction manual is

Genome size1 232 280 000 bp

Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).

BACTERIUM Carsonella ruddii0.00016 Gb

FUNGUS0.04 Gb

INSECT0.25 Gb

THIS GENOME Amphibalanus eburneus1.23 Gb

HUMAN3.2 Gb

WHEAT17 Gb

FERN Tmesipteris160.45 Gb

08Occurrence & distribution

Record type1 405 records

Wild obs. + sensor772

Museum / vouchered594

Fossil4

Other35

Range

Area of Occupancy AOO1 832 km²

Depth

0–200 m sunlit86

200–1000 m twilight0

1–4 km midnight0

>4 km abyssal0

median 14.6 m · max 42 m · 86 records with depth

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy87% within 1 km

≤100 m 113≤1 km 25≤10 km 17>10 km 4

159 georeferenced · 613 without coordinates

Open the mapobservation + sensor772

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy58% within 1 km

≤100 m 50≤1 km 19≤10 km 37>10 km 12

118 georeferenced · 476 without coordinates

Open the institutions mapphysical evidence594

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions9 of 23 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
National Marine Biodiversity Institute of Korealocation not on record	104
Museu Nacional/Universidade Federal do Rio de Janeirolocation not on record	49
San Nicolás de los Garza, MX	42
CASlocation not on record	30
Washington, US	25
Florida Museum of Natural History- Zoology, Paleontology & Paleobotanylocation not on record	23
Honolulu, US	21
AUTHlocation not on record	21
Institut Francais pour l'Etude de la Merlocation not on record	6
Santa Barbara Museum of Natural Historylocation not on record	5
Stockholm, SE	4
486location not on record	3
New Haven, US	2
Florida Atlantic University, Harbor Branch Oceanographic Museumlocation not on record	2
ARMS-MBONlocation not on record	2
Museum für Naturkunde Berlin (Zoological Collections)location not on record	2
Instituto de Investigaciones Marinas y Costeras José Benito Vives de Andreis - Invemarlocation not on record	1
University of Guelphlocation not on record	1
Paris, FR	1
UKRSCESlocation not on record	1
Auckland, NZ	1
Los Angeles, US	1
Chicago, US	1

23 institutions · 348 of 594 vouchered records shown · 26 without an institution code

09Environmental DNA73 detections

Where the DNA of Amphibalanus eburneus was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found73

Studies independent surveys2

Countries4

Verifiable raw sequence linked2

Signal confidence: moderateweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 73 detections have coordinates

Open the map4 countries0

Marina; semi-industrial; 9.6 - Subtidal MuddyMarina; semi-industrial; 9.5 - Subtidal Sand…

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median14.9 °C 12.5–33.8

Seasonal swing summer↔winter21.3 °C

Max temp (day)18.5 °C 16.5–39.2

Min temp (night)12.8 °C 8.20–25.6

Precipitation79.4 mm/mo 0.6–101

Air humidity58.7 % 35.0–63.4

Moisture balance-38.4 mm/mo

Vapour deficit693 Pa 613–3,537

Wind speed5.10 m/s

Cloud cover36.7 % 7.80–56.1

CHELSA 1981–2010, ~9 km grid, at location & month of 22 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Amphibalanus eburneus

At a glance

Sources9 archives

Size & morphology1

Habitat & environment2

At a glance

Genome sizehow big the whole instruction manual is

Record type1 405 records

Range

Depth

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions9 of 23 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type1 405 records