Amphasia sericea

(T.W.Harris, 1828) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Coleoptera/Carabidae/Amphasia

At a glance

Occurrence records897

Data sources9

Biological traits0

DNA specimens59

eDNA detections54

Sources9 archives

Databases and archives Amphasia sericea's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility897 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI54 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics59 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GoaTGenomes on a Tree · Sangergenome & karyotype↗

Tree of SexTree of Sex Consortiumgenome & karyotype↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF897 records

Environmental DNA1 datasets · 2 countries54 detections

DNA & barcodingBOLD59 specimens

Genome at a glanceGoaT · TreeOfSex2n = 30

01Narrative

Amphasia sericea is a species of ground beetle in the family Carabidae. It is found in North America.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding59 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Amphasia sericea has left across the world's sequence archives.

At a glance

DNA specimens59

BINs1

Marker genes1

eDNA detections54

Countries2

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus52 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 99% of positions are identical in every specimen.

Where individuals differ — all 9 variable positions, in barcode order

235Tmostly conserved

284Tvariable

289Cmostly conserved

343Amostly conserved

415Amostly conserved

478Amostly conserved

613Cmostly conserved

622Amostly conserved

628Gmostly conserved

AACATTATATTTTATTTTTGGAGCATGATCAGGAATAGTAGGGACTTCATTAAGTATATTAATTCGAATAGAATTAGGAACTCCTGGTGC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.39%

Haplotypes28

BIN1

Most divergent pair1.5%

N.America

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Anisodactylus binotatussame family7.0%Anisodactylus discoideussame family7.1%Anisodactylus furvussame family7.1%Anisodactylus signatussame family7.6%Xestonotus lugubrissame family7.6%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

06Genome at a glanceGoaT · TreeOfSex

The complete instruction manual Amphasia sericea carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 30 n = 15

Ploidy2× diploid · measured

Chromosome records30–302n range30median30mode3records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 293×GoaT · Animal Chromosome Counts Database · GoaT · Tree of Sex Database · GoaT · Coleoptera Karyotype Database

GoaT · Animal Chromosome Counts Database — ↗

GoaT · Tree of Sex Database — ↗

GoaT · Coleoptera Karyotype Database — ↗

2n 303×GoaT · Animal Chromosome Counts Database · GoaT · Tree of Sex Database · TreeOfSex · invert

GoaT · Animal Chromosome Counts Database — ↗

GoaT · Tree of Sex Database — ↗

TreeOfSex · invert — Serrano J, Yadav JS (1984) Chromosome numbers and sex-determining mechanisms in adephagan Coleoptera. Coleopt Bull 38: 335-357. ↗

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

diploid1×GoaT · Coleoptera Karyotype Database

GoaT · Coleoptera Karyotype Database

08Occurrence & distribution

Record type897 records

Wild obs. + sensor343

Museum / vouchered554

Range

Area of Occupancy AOO1 444 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy83% within 1 km

≤100 m 178≤1 km 79≤10 km 12>10 km 42

311 georeferenced · 32 without coordinates

Open the mapobservation + sensor343

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy55% within 1 km

≤100 m 109≤1 km 15≤10 km 91>10 km 9

224 georeferenced · 330 without coordinates

Open the institutions mapphysical evidence554

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions11 of 24 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
University of Alberta Museums (UAM)location not on record	171
Tempe, US	114
University Park, US	41
OSUClocation not on record	40
University of Guelph, Centre for Biodiversity Genomicslocation not on record	16
University of Guelphlocation not on record	15
US	12
North Carolina State University Insect Museumlocation not on record	12
University of Alabamalocation not on record	11
College Station, US	10
Colorado State Universitylocation not on record	8
Wuzhou, CN	8
Toronto, CA	8
Lexington, US	8
Provo, US	7
Cambridge, US	7
Decorah, US	6
Champaign, US	6
UDlocation not on record	5
EWIClocation not on record	4
CUlocation not on record	2
NEON Biorepository at Arizona State Universitylocation not on record	1
Royal Saskatchewan Museumlocation not on record	1
Espace pour la vielocation not on record	1

24 institutions · 514 of 554 vouchered records shown · 40 without an institution code

09Environmental DNA54 detections

Where the DNA of Amphasia sericea was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found54

Studies independent surveys1

Countries2

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 54 detections have coordinates

Open the map2 countries0

deciduousForestForestcultivatedCropspastureHaygrasslandHerbaceousemergentHerbaceousWetlands

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median21.7 °C 13.9–22.8

Seasonal swing summer↔winter26.9 °C

Max temp (day)24.2 °C 17.2–27.7

Min temp (night)17.9 °C 10.9–19.9

Precipitation95.3 mm/mo 78.7–117

Air humidity58.0 % 57.1–60.8

Moisture balance-64.1 mm/mo -97.2–-16.4

Vapour deficit1,086 Pa 755–1,168

Wind speed4.00 m/s 3.60–6.10

Cloud cover39.2 % 36.6–42.3

CHELSA 1981–2010, ~9 km grid, at location & month of 51 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)