Amphasia interstitialis

(Say, 1823) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Coleoptera/Carabidae/Amphasia

At a glance

Occurrence records1 243

Data sources7

Biological traits0

DNA specimens68

eDNA detections60

Sources7 archives

Databases and archives Amphasia interstitialis's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility1 243 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI60 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics68 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF1 243 records

Environmental DNA1 datasets · 2 countries60 detections

DNA & barcodingBOLD68 specimens

01Narrative

Amphasia interstitialis is a species of ground beetle in the family Carabidae. It is found in North America.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding68 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Amphasia interstitialis has left across the world's sequence archives.

At a glance

DNA specimens68

BINs2

Marker genes1

eDNA detections60

Countries3

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus54 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 99% of positions are identical in every specimen.

Where individuals differ — all 4 variable positions, in barcode order

181Gmostly conserved

289Tmostly conserved

382Amostly conserved

562Gvariable

AACATTATATTTTATTTTTGGAGCATGAGCAGGAATAGTAGGAACTTCATTAAGTATATTAATTCGAGCAGAACTAGGAACTCCTGGTGC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)1.2%

Haplotypes12

BINs2

Most divergent pair15.0%

N.America

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Amphasia sericeasame genus7.6%Anisodactylus furvussame family8.2%Harpalus attenuatussame family8.5%Trichotichnus autumnalissame family8.5%Anisodactylus binotatussame family8.7%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type1 243 records

Wild obs. + sensor649

Museum / vouchered594

Range

Area of Occupancy AOO2 972 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy84% within 1 km

≤100 m 316≤1 km 133≤10 km 30>10 km 54

533 georeferenced · 116 without coordinates

Open the mapobservation + sensor649

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy46% within 1 km

≤100 m 123≤1 km 17≤10 km 145>10 km 17

302 georeferenced · 292 without coordinates

Open the institutions mapphysical evidence594

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions10 of 28 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
OSUClocation not on record	144
Tempe, US	137
University of Alberta Museums (UAM)location not on record	61
University Park, US	54
Lexington, US	27
Provo, US	24
Decorah, US	19
University of Guelphlocation not on record	12
EWIClocation not on record	11
NEON Biorepository at Arizona State Universitylocation not on record	8
Colorado State Universitylocation not on record	7
CUlocation not on record	6
UDlocation not on record	5
University of Alabamalocation not on record	5
Espace pour la vielocation not on record	4
Wuzhou, CN	4
Sam Noble Oklahoma Museum of Natural Historylocation not on record	3
ASUlocation not on record	3
North Carolina State University Insect Museumlocation not on record	3
Saint John, CA	2
ERWClocation not on record	2
McGill University, Lyman Entomological Museumlocation not on record	1
Canadian Centre for DNA Barcodinglocation not on record	1
Carnegie Museum of Natural Historylocation not on record	1
New Haven, US	1
College Station, US	1
Essig Museum of Entomologylocation not on record	1
Lubbock, US	1

28 institutions · 548 of 594 vouchered records shown · 46 without an institution code

09Environmental DNA60 detections

Where the DNA of Amphasia interstitialis was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found60

Studies independent surveys1

Countries2

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 60 detections have coordinates

Open the map2 countries0

evergreenForestpastureHaydeciduousForestForest

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median18.4 °C 12.6–22.4

Seasonal swing summer↔winter24.1 °C

Max temp (day)23.7 °C 17.8–27.7

Min temp (night)14.4 °C 6.80–17.6

Precipitation105 mm/mo 91.2–122

Air humidity57.2 % 55.4–59.9

Moisture balance-29.0 mm/mo -59.8–0.1

Vapour deficit897 Pa 661–1,160

Wind speed3.00 m/s 2.10–3.90

Cloud cover39.4 % 32.5–43.8

CHELSA 1981–2010, ~9 km grid, at location & month of 58 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Amphasia interstitialis

At a glance

Sources7 archives

At a glance

Record type1 243 records

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions10 of 28 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type1 243 records