Ampharete falcata

Eliason, 1955 · species

image placeholder — illustration coming later

Animalia/Annelida/Polychaeta/Ampharetidae/Ampharete

At a glance

Occurrence records20 810

Data sources7

Biological traits2

DNA specimens11

eDNA detections4

Sources7 archives

Databases and archives Ampharete falcata's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility10 787 records↗

OBISOcean Biodiversity Information System10 023 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI4 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics11 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

Catalogue of LifeCOLtaxonomy↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources2 traits

Occurrence & distributionGBIF · OBIS20 810 records

Environmental DNA1 datasets · 1 countries4 detections

DNA & barcodingBOLD11 specimens

01Narrative

Ampharete falcata is een borstelworm uit de familie Ampharetidae. Het lichaam van de worm bestaat uit een kop, een cilindrisch, gesegmenteerd lichaam en een staartstukje. De kop bestaat uit een prostomium en een peristomium en draagt gepaarde aanhangsels. Ampharete falcata werd in 1955 voor het eerst wetenschappelijk beschreven door Eliason. Deze inheemse soort komt voor in de Nederlandse Noordzee.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesSeaLifeBase

Habitat & environment2

Habitat saltwateryes

Habitat zonebenthic

05DNA & barcoding11 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Ampharete falcata has left across the world's sequence archives.

At a glance

DNA specimens11

BINs1

Marker genes2

eDNA detections4

Countries1

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P613 bp consensus8 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 98% of positions are identical in every specimen.

Where individuals differ — all 12 variable positions, in barcode order

92Cmostly conserved

264Gmostly conserved

320Tmostly conserved

323Tmostly conserved

329Amostly conserved

332Amostly conserved

335Gmostly conserved

371Tmostly conserved

374Cmostly conserved

497Tmostly conserved

515Tvariable

584Amostly conserved

CAATATACTTTATTAGTGGGATTTGGGGTGGCTTACTAGGTACAATATTGAGTTTAATTATTCGTGTTGAATTAGGACAACCTGGATCAT …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.58%

Haplotypes5

BIN1

Most divergent pair0.82%

Europe

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Ampharete finmarchicasame genus14.0%Ampharete undecimasame genus14.8%Ampharete acutifronssame genus15.2%Ampharete octocirratasame genus15.8%Anobothrus gracilissame family16.0%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P18S-5P

animal barcoderibosomal

08Occurrence & distribution

Record type20 810 records

Wild obs. + sensor2 271

Museum / vouchered17 773

Fossil1

Other765

Range

Area of Occupancy AOO8 216 km²

Depth

0–200 m sunlit8 458

200–1000 m twilight670

1–4 km midnight1

>4 km abyssal0

median 111.9 m · max 1 174 m · 9 129 records with depth

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy98% within 1 km

≤100 m 1 853≤1 km 3≤10 km 32

1 888 georeferenced · 383 without coordinates

Open the mapobservation + sensor2 271

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy100% within 1 km

≤100 m 134≤1 km 26

160 georeferenced · 17 613 without coordinates

Open the institutions mapphysical evidence17 773

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions4 of 15 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
CEFASlocation not on record	662
DASSHlocation not on record	64
730location not on record	59
Bergen, NO	21
Norwegian Institute of Marine Researchlocation not on record	15
Biomorlocation not on record	9
Stockholm, SE	8
Zoological Museum, Moscow Lomonosov State Universitylocation not on record	8
University Museum of Bergen, Natural History Collectionslocation not on record	6
NTNU-VMlocation not on record	5
Frankfurt am Main	5
SLU Artdatabankenlocation not on record	4
Observatoire Océanologique de Banyuls-Sur-Mer; Laboratoire d'Océanographie Biologiquelocation not on record	3
Gothenburg, SE	2
ArcODlocation not on record	1

15 institutions · 872 of 17 773 vouchered records shown · 7 715 without an institution code

09Environmental DNA4 detections

Where the DNA of Ampharete falcata was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found4

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 4 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median10.4 °C 10.4–10.4

Seasonal swing summer↔winter16.1 °C

Max temp (day)11.7 °C

Min temp (night)9.20 °C

Precipitation57.8 mm/mo

Air humidity58.0 %

Vapour deficit530 Pa

Cloud cover40.7 %

CHELSA 1981–2010, ~9 km grid, at location & month of 2 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Ampharete falcata

At a glance

Sources7 archives

Habitat & environment2

At a glance

Record type20 810 records

Range

Depth

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions4 of 15 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type20 810 records