Anobothrus gracilis
(Malmgren, 1866) · speciesAt a glance
Occurrence records32 543
Data sources7
Biological traits4
DNA specimens17
eDNA detections180
Sources7 archives
Databases and archives Anobothrus gracilis's data was compiled from.
BioWikiNetmultilingual Wikipediamultilingual↗
GBIFGlobal Biodiversity Information Facility17 871 records↗
OBISOcean Biodiversity Information System14 672 records↗
ENAEuropean Nucleotide Archive · EMBL-EBI180 eDNA detections↗
BOLD SystemsCentre for Biodiversity Genomics17 specimens↗
Open Tree of LifeOpenTreephylogeny backbone↗
Catalogue of LifeCOLtaxonomy↗On this page5 sections
Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.
NarrativeWikipediaarticle
Traits & measurements1 literature sources4 traits
Occurrence & distributionGBIF · OBIS32 543 records
Environmental DNA10 datasets · 11 countries180 detections
DNA & barcodingBOLD17 specimens
01Narrative
Anobothrus gracilis is een borstelworm uit de familie Ampharetidae. Het lichaam van de worm bestaat uit een kop, een cilindrisch, gesegmenteerd lichaam en een staartstukje. De kop bestaat uit een prostomium en een peristomium en draagt gepaarde aanhangsels. Anobothrus gracilis werd in 1866 voor het eerst wetenschappelijk beschreven door Malmgren.
No narrative description available for this taxon yet.
02Traits & measurements
SourcesSeaLifeBase
Habitat & environment2
Habitat saltwateryes
Habitat zonebenthic
Other traits2
Depth max2 900 m
Depth min10 m
05DNA & barcoding17 specimens
A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Anobothrus gracilis has left across the world's sequence archives.
At a glance
DNA specimens17
BINs2
Marker genes2
eDNA detections180
Countries11
The DNA barcodethe species' typical barcode, built from every sequenced specimen
COI-5P657 bp consensus7 specimens
ACGT
▸ drag or hover over the strip to read any position — letter and how much it varies
Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 93% of positions are identical in every specimen.
Diversity (π)2.6%
Haplotypes1
BINs2
Where individuals differ — all 48 variable positions, in barcode order
6Amostly conserved
9Tmostly conserved
14Tmostly conserved
21Gmostly conserved
30Amostly conserved
37Tmostly conserved
39Gmostly conserved
54Cmostly conserved
69Cmostly conserved
73Cmostly conserved
81Amostly conserved
87Amostly conserved
114Cvariable
117Tvariable
171Amostly conserved
198Amostly conserved
201Gmostly conserved
204Amostly conserved
207Gmostly conserved
228Gmostly conserved
246Cmostly conserved
250Tmostly conserved
255Gmostly conserved
261Gmostly conserved
270Tmostly conserved
285Amostly conserved
306Amostly conserved
321Tmostly conserved
330Amostly conserved
333Amostly conserved
354Amostly conserved
378Amostly conserved
432Gvariable
459Tvariable
477Tmostly conserved
501Amostly conserved
510Gmostly conserved
528Gmostly conserved
532Cmostly conserved
535Cmostly conserved
543Cmostly conserved
555Amostly conserved
585Tmostly conserved
618Amostly conserved
627Amostly conserved
633Tmostly conserved
640Tmostly conserved
648Gvariable
ACTTTATATTTTATTAGTGGGATTTGAGGAGGTTTATTGGGGACAGTTTTAAGCTTAATAATTCGTGTCGAGCTAGGACAACCTGGATCA …
Closest relatives by DNA barcode
The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.
Marker genes sequenced
★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.
★COI-5P18S-5P
animal barcoderibosomal
08Occurrence & distribution
Record type32 543 records
Wild obs. + sensor6 520
Museum / vouchered20 593
Other5 430
Range
Area of Occupancy AOO17 872 km²
Depth
0–200 m sunlit10 353
200–1000 m twilight511
1–4 km midnight50
>4 km abyssal4
median 96.5 m · max 4 817 m · 10 918 records with depth
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
Coordinate accuracy99% within 1 km
≤100 m 5 174≤1 km 142≤10 km 31>10 km 1
5 348 georeferenced · 1 172 without coordinates
Open the mapobservation + sensor6 520
Museum / Voucheredphysical evidence
Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.
Coordinate accuracy93% within 1 km
≤100 m 331≤1 km 384≤10 km 23>10 km 34
772 georeferenced · 19 821 without coordinates
Open the institutions mapphysical evidence20 593
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
10Collections & institutions
Holding institutions12 of 56 geolocated
Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.
| Institution | Specimens |
|---|---|
| CEFASlocation not on record | 880 |
| 730location not on record | 768 |
| Washington, US | 337 |
| MZLUlocation not on record | 278 |
| SLU Artdatabankenlocation not on record | 169 |
| Gothenburg, SE | 139 |
| Norwegian Institute of Marine Researchlocation not on record | 137 |
| Bergen, NO | 134 |
| Stockholm, SE | 125 |
| DASSHlocation not on record | 118 |
| NHMOlocation not on record | 84 |
| Observatoire Océanologique de Banyuls-Sur-Mer; Laboratoire d'Océanographie Biologiquelocation not on record | 66 |
| NTNU-VMlocation not on record | 64 |
| Bergen, NO | 53 |
| The Atlantic reference Centrelocation not on record | 38 |
| Zoological Museum, Moscow Lomonosov State Universitylocation not on record | 38 |
| Maurice Lamontagne Institutelocation not on record | 29 |
| Los Angeles, US | 26 |
| RWSlocation not on record | 25 |
| Institut Francais pour l'Etude de la Merlocation not on record | 23 |
| New Haven, US | 18 |
| Museo civico La Terra e l'Uomo di Crocetta del Montellolocation not on record | 15 |
| 486location not on record | 15 |
| Instituto de Investigaciones Oceanológicas, Universidad Autónoma de Baja Californialocation not on record | 12 |
| CASlocation not on record | 10 |
| Santa Barbara Museum of Natural Historylocation not on record | 9 |
| Univ_Ryukyuslocation not on record | 7 |
| Eco laboratory geochemistry Benthic Environments UMR 8222 (4503) Université de Liège Underwater research and oceanographic station (4501)location not on record | 5 |
| Université de Liège Underwater research and oceanographic station (4501)location not on record | 5 |
| PNHSlocation not on record | 4 |
| Biomorlocation not on record | 4 |
| Saint John, CA | 4 |
| ArCODlocation not on record | 4 |
| Toronto, CA | 4 |
| Victoria, CA | 4 |
| Hellenic Centre of Marine Research; Institute for Oceanographylocation not on record | 4 |
| Instytut Oceanologii Polskiej Akademii Nauklocation not on record | 3 |
| Johanna Bergkvistlocation not on record | 3 |
| Stockholm, SE | 3 |
| CSIC-CEAB Centre for Advanced Studies of Blanes (1393) Eco laboratory geochemistry Benthic Environments UMR 8222 (4503) Phaxas Expertise Of Marine Fauna (4507) Université de Liège Underwater research and oceanographic station (4501)location not on record | 3 |
| Israel Oceanographic & Limnological Research, Ltd. The National Institute of Oceanographylocation not on record | 3 |
| University Museum of Bergen, Natural History Collectionslocation not on record | 3 |
| Hellenic Centre for Marine Research-Institute of Marine Biology, Biotechnology and Aquaculturelocation not on record | 3 |
| ArcODlocation not on record | 3 |
| The Atlantic Reference Centre (ARC)location not on record | 2 |
| Florida Museum of Natural History- Zoology, Paleontology & Paleobotanylocation not on record | 2 |
| BioFokuslocation not on record | 2 |
| Montgomery, US | 2 |
| CoNISMalocation not on record | 2 |
| Zoologisches Museum Hamburglocation not on record | 1 |
| CSIC-CEAB Centre for Advanced Studies of Blanes (1393) Phaxas Expertise Of Marine Fauna (4507)location not on record | 1 |
| Eco laboratory geochemistry Benthic Environments UMR 8222 (4503) Phaxas Expertise Of Marine Fauna (4507)location not on record | 1 |
| Phaxas Expertise Of Marine Fauna (4507)location not on record | 1 |
| CSIC-CEAB Centre for Advanced Studies of Blanes (1393) Eco laboratory geochemistry Benthic Environments UMR 8222 (4503) Université de Liège Underwater research and oceanographic station (4501)location not on record | 1 |
| CSIC-CEAB Centre for Advanced Studies of Blanes (1393)location not on record | 1 |
| Eco laboratory geochemistry Benthic Environments UMR 8222 (4503)location not on record | 1 |
56 institutions · 3 696 of 20 593 vouchered records shown · 7 062 without an institution code
09Environmental DNA180 detections
Where the DNA of Anobothrus gracilis was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.
Signal
Detections DNA found180
Studies independent surveys10
Countries11
Verifiable raw sequence linked70
Signal confidence: moderateweighed across independent studies, places & mapped detections
Where its DNA was found
0 of 180 detections have coordinates
Open the map11 countries0
marine benthic biomeMexico, Gulf ofAtlantic Ocean
How strong is each trace?
DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.
Measured at samplingin-field
Temperature25.1 °C 12.1–31.5
pH8.16 7.97–8.20
Conductivity53,549 µS/cm 40,368–60,345
Salinity35.2 PSU 32.2–36.0
Dissolved oxygen7.13 mg/L 5.58–9.63
Turbidity0.379 NTU 0.075–10.9
Nitrate0.5 µmol/L 0.1–9.90
Sand98.9 %
Depth18.0 m 0–1,226
Coastal waterPelagicSediment
73 samples with on-site data · median with range · describes the sample, not the organism
Modelled climatemodelled
−15°Ctemperature across detection sites+40°C
Temperature median20.0 °C -2.30–27.3
Seasonal swing summer↔winter7.40 °C
Max temp (day)21.2 °C 0.2–29.0
Min temp (night)18.2 °C -6.10–26.2
Precipitation101 mm/mo 18.4–169
Air humidity60.3 % 54.9–65.2
Vapour deficit930 Pa 197–1,484
Cloud cover38.3 % 20.4–63.4
CHELSA 1981–2010, ~9 km grid, at location & month of 178 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche
How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.