Ampedus tristis

(Linnaeus, 1758) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Coleoptera/Elateridae/Ampedus

At a glance

Occurrence records3 436

Data sources6

Biological traits2

DNA specimens8

eDNA detections22

Sources6 archives

Databases and archives Ampedus tristis's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility3 436 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI22 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics8 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources2 traits

Occurrence & distributionGBIF3 436 records

Environmental DNA3 datasets · 5 countries22 detections

DNA & barcodingBOLD8 specimens

01Narrative

Ampedus tristis est une espèce de taupins du genre Ampedus que l'on trouve sur les vieux pins et les arbres tombés des forêts de pins de certaines régions d'Europe du Nord, de Scandinavie et d'Écosse, jusqu'en Russie européenne et en Sibérie occidentale. Elle a été décrite par Carl von Linné dans son Systema naturae en 1758 sous le nom d'Elater tristis.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesPantheon

Diet & foraging2

Feeding guild (adult)does not feed

Feeding guild (larval)predator

05DNA & barcoding8 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Ampedus tristis has left across the world's sequence archives.

At a glance

DNA specimens8

BINs1

Marker genes2

eDNA detections22

Countries5

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus7 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 98% of positions are identical in every specimen.

Where individuals differ — all 12 variable positions, in barcode order

13Tmostly conserved

22Gvariable

85Tmostly conserved

202Gvariable

217Amostly conserved

229Amostly conserved

271Amostly conserved

346Avariable

401Tmostly conserved

544Tmostly conserved

622Gvariable

628Amostly conserved

AACCCTATACTTTATCTTTGGGGCATGGGCCGGTATACTAGGAACATCCCTAAGTCTGTTAATCCGTGCCGAATTAGGAAACCCTGGATC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.67%

Haplotypes5

BIN1

Most divergent pair1.2%

Europe

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Ampedus phelpsisame genus5.6%Ampedus meloniisame genus7.1%Ampedus praeustussame genus7.3%Ampedus anthracinussame genus7.6%Ampedus cardinalissame genus7.6%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P★ITS2

animal barcodefungal barcode

08Occurrence & distribution

Record type3 436 records

Wild obs. + sensor1 932

Museum / vouchered1 494

Fossil1

Other9

Origin

Native6

Range

Area of Occupancy AOO5 476 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy97% within 1 km

≤100 m 1 441≤1 km 376≤10 km 52>10 km 4

1 873 georeferenced · 59 without coordinates

Open the mapobservation + sensor1 932

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy89% within 1 km

≤100 m 1 097≤1 km 182≤10 km 147>10 km 18

1 444 georeferenced · 50 without coordinates

Open the institutions mapphysical evidence1 494

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions13 of 32 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Trondheim, NO	407
NMBU:MINAlocation not on record	391
SLU Artdatabankenlocation not on record	222
Metsähallituslocation not on record	99
Olocation not on record	46
Helsinki, FI	42
NHMOlocation not on record	37
Jyväskylä, FI	32
MZLUlocation not on record	20
Tallinn, EE	17
NTNU-VMlocation not on record	15
BioFokuslocation not on record	10
Tromsø, NO	8
LSMlocation not on record	7
Kuopio, FI	7
Tartu, EE	7
Oulu, FI	6
Rovaniemi, FI	6
neflocation not on record	5
Dhaka, BD	4
IFR-DNFlocation not on record	4
TMPMlocation not on record	4
Provincia di Livornolocation not on record	3
Norwegian University of Life Sciences (NMBU)location not on record	3
Laboratorium voor Microbiologie der Landbouwhogeschoollocation not on record	2
Stockholm, SE	2
Natural History Museum Rotterdamlocation not on record	2
SGAV-and-NHMDlocation not on record	1
CBDClocation not on record	1
ZMAAlocation not on record	1
Salzburg, AT	1
Philadelphia, US	1

32 institutions · 1 413 of 1 494 vouchered records shown · 81 without an institution code

09Environmental DNA22 detections

Where the DNA of Ampedus tristis was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found22

Studies independent surveys3

Countries5

Verifiable raw sequence linked14

Signal confidence: moderateweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 22 detections have coordinates

Open the map5 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median13.2 °C 7.60–15.2

Seasonal swing summer↔winter24.1 °C

Max temp (day)16.4 °C 11.2–18.6

Min temp (night)8.10 °C 2.10–10.9

Precipitation66.0 mm/mo 50.2–106

Air humidity56.5 % 55.5–60.7

Moisture balance-32.2 mm/mo -44.0–0.5

Vapour deficit643 Pa 464–724

Wind speed2.70 m/s 1.90–3.70

Cloud cover49.0 % 43.8–56.4

CHELSA 1981–2010, ~9 km grid, at location & month of 21 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Ampedus tristis

At a glance

Sources6 archives

Diet & foraging2

At a glance

Record type3 436 records

Origin

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions13 of 32 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type3 436 records