Ampedus linteus

(Say, 1839) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Coleoptera/Elateridae/Ampedus

At a glance

Occurrence records178

Data sources6

Biological traits0

DNA specimens14

eDNA detections13

Sources6 archives

Databases and archives Ampedus linteus's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility178 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI13 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics14 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF178 records

Environmental DNA1 datasets · 2 countries13 detections

DNA & barcodingBOLD14 specimens

01Narrative

Ampedus linteus is een keversoort uit de familie kniptorren (Elateridae). De wetenschappelijke naam van de soort is voor het eerst geldig gepubliceerd in 1839 door Thomas Say.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding14 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Ampedus linteus has left across the world's sequence archives.

At a glance

DNA specimens14

BINs1

Marker genes1

eDNA detections13

Countries2

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus13 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 98% of positions are identical in every specimen.

Where individuals differ — all 10 variable positions, in barcode order

7Cmostly conserved

25Gvariable

85Cvariable

88Gvariable

175Gvariable

196Gvariable

199Amostly conserved

211Gmostly conserved

389Gmostly conserved

616Tvariable

AACCCTCTACTTTATCTTTGGTGCGTGAGCAGGAATACTAGGTACATCCCTAAGCCTACTCATCCGTGCCGAACTAGGAAACCCCGGGTC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.57%

Haplotypes6

BIN1

Most divergent pair0.91%

N.America

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Ampedus occidentalissame genus9.0%Ampedus apicatussame genus9.1%Ampedus nigricollissame genus9.1%Ampedus corsicussame genus9.4%Ampedus behrensisame genus9.6%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type178 records

Wild obs. + sensor140

Museum / vouchered38

Range

Area of Occupancy AOO580 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy77% within 1 km

≤100 m 71≤1 km 21≤10 km 8>10 km 19

119 georeferenced · 21 without coordinates

Open the mapobservation + sensor140

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy9% within 1 km

≤100 m 2≤10 km 3>10 km 17

22 georeferenced · 16 without coordinates

Open the institutions mapphysical evidence38

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions4 of 9 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Lexington, US	19
University of Guelph, Centre for Biodiversity Genomicslocation not on record	5
MAJClocation not on record	2
East Lansing, US	2
University of Guelphlocation not on record	1
Espace pour la vielocation not on record	1
Biodiversity Institute of Ontariolocation not on record	1
Champaign, US	1
University Park, US	1

9 institutions · 33 of 38 vouchered records shown · 5 without an institution code

09Environmental DNA13 detections

Where the DNA of Ampedus linteus was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found13

Studies independent surveys1

Countries2

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 13 detections have coordinates

Open the map2 countries0

1. Forest & WoodlandForestFloodplain forest1. Forest & Woodland|1.4. Temperate Forest14. Artificial - Terrestrial|14.5 Urban AreasMixed habitat

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median13.4 °C 6.70–19.2

Seasonal swing summer↔winter27.2 °C

Max temp (day)18.9 °C 9.60–22.5

Min temp (night)8.40 °C 4.40–16.8

Precipitation89.4 mm/mo 85.5–110

Air humidity57.1 % 55.1–59.6

Moisture balance-37.7 mm/mo -78.6–-7.10

Vapour deficit682 Pa 409–898

Wind speed3.90 m/s 2.80–6.10

Cloud cover45.7 % 40.7–46.6

CHELSA 1981–2010, ~9 km grid, at location & month of 12 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)