Amnestus pusillus

Uhler, 1876 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Hemiptera/Cydnidae/Amnestus

At a glance

Occurrence records228

Data sources6

Biological traits0

DNA specimens11

eDNA detections8

Sources6 archives

Databases and archives Amnestus pusillus's data was compiled from.

WikipediaWikimedia Foundation1 languages↗

GBIFGlobal Biodiversity Information Facility228 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI8 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics11 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF228 records

Environmental DNA1 datasets · 1 countries8 detections

DNA & barcodingBOLD11 specimens

01Narrative

Amnestus pusillus is a species of burrowing bug in the family Cydnidae. It is found in the Caribbean Sea, Central America, and North America.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding11 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Amnestus pusillus has left across the world's sequence archives.

At a glance

DNA specimens11

BINs1

Marker genes1

eDNA detections8

Countries1

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P636 bp consensus8 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 99% of positions are identical in every specimen.

Diversity (π)0.38%

Haplotypes1

BIN1

Where individuals differ — all 6 variable positions, in barcode order

51Gmostly conserved

84Tmostly conserved

108Tmostly conserved

441Cmostly conserved

552Tvariable

609Gvariable

ATATGGGCAGGAATAATTGGAACATCCCTTAGTTGAATTATTCGAATTGAGTTAGGAACTCCTGGATCATTTATTGGAGATGATCAAATT …

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Amnestus pusiosame genus15.7%Remaudiereana nigricepssame order16.4%Neoneides muticussame order16.4%Sphragisticus nebulosussame order17.0%Nysius raphanussame order17.1%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type228 records

Wild obs. + sensor20

Museum / vouchered208

Origin

Native1

Range

Area of Occupancy AOO324 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy64% within 1 km

≤100 m 8≤1 km 1≤10 km 1>10 km 4

14 georeferenced · 6 without coordinates

Open the mapobservation + sensor20

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy55% within 1 km

≤100 m 6≤1 km 10≤10 km 13

29 georeferenced · 179 without coordinates

Open the institutions mapphysical evidence208

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions9 of 14 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
College Station, US	67
Cambridge, US	33
Wuzhou, CN	25
Champaign, US	23
University of Guelphlocation not on record	22
Mississippi State, US	15
University of Guelph, Centre for Biodiversity Genomicslocation not on record	5
The University of the West Indies, Trinidad and Tobagolocation not on record	4
University Park, US	2
University of Central Floridalocation not on record	2
CUlocation not on record	1
Lubbock, US	1
Philadelphia, US	1
Washington, US	1

14 institutions · 202 of 208 vouchered records shown · 6 without an institution code

09Environmental DNA8 detections

Where the DNA of Amnestus pusillus was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found8

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 8 detections have coordinates

Open the map1 country0

farmWetlandMixed habitatRiparian Zone

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median24.1 °C 15.8–24.1

Seasonal swing summer↔winter27.7 °C

Max temp (day)26.5 °C 20.4–26.5

Min temp (night)22.5 °C 11.7–22.5

Precipitation98.1 mm/mo 88.9–98.1

Air humidity57.9 % 57.0–58.0

Moisture balance-110 mm/mo -110–-45.6

Vapour deficit1,262 Pa 777–1,262

Wind speed5.70 m/s 3.20–5.80

Cloud cover35.3 % 35.3–43.3

CHELSA 1981–2010, ~9 km grid, at location & month of 7 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)