Ammothea hilgendorfi

(Böhm, 1879) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Pycnogonida/Pantopoda/Ammotheidae/Ammothea

At a glance

Occurrence records1 136

Data sources8

Biological traits2

DNA specimens18

eDNA detections19

Sources8 archives

Databases and archives Ammothea hilgendorfi's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility860 records↗

OBISOcean Biodiversity Information System276 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI19 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics18 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GoaTGenomes on a Tree · Sangergenome ~0.42 Gbp↗

Catalogue of LifeCOLtaxonomy↗

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources2 traits

Occurrence & distributionGBIF · OBIS1 136 records

Environmental DNA2 datasets · 4 countries19 detections

DNA & barcodingBOLD18 specimens

Genome at a glanceGoaT421 Mbp

01Narrative

De zebrazeespin is een zeespin uit de familie Ammotheidae. Ammothea hilgendorfi werd in 1879 voor het eerst wetenschappelijk beschreven door Böhm. Hij noemde hem naar Franz Martin Hilgendorf. In november 2013 werd deze zeespin aangetroffen in de Oosterschelde, terwijl deze oorspronkelijk uit de Grote Oceaan komt. Ammothea hilgendorfi lijkt het goed te doen in het Nederlandse water, er werden meerdere exemplaren aangetroffen.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesSeaLifeBase

Habitat & environment2

Habitat saltwateryes

Habitat zonebenthic

05DNA & barcoding18 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Ammothea hilgendorfi has left across the world's sequence archives.

At a glance

DNA specimens18

BINs2

Marker genes3

eDNA detections19

Countries4

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus13 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 77% of positions are identical in every specimen.

Where individuals differ — all 151 variable positions, in barcode order

1Amostly conserved

3Cmostly conserved

4Tmostly conserved

5Amostly conserved

6Tmostly conserved

7Amostly conserved

9Amostly conserved

10Tmostly conserved

11Tmostly conserved

13Amostly conserved

14Amostly conserved

16Cmostly conserved

17Tmostly conserved

18Tmostly conserved

20Gmostly conserved

21Gmostly conserved

22Amostly conserved

23Amostly conserved

24Tmostly conserved

25Tmostly conserved

27Gmostly conserved

29Tmostly conserved

32Gmostly conserved

33Cmostly conserved

35Amostly conserved

39Tmostly conserved

41Gmostly conserved

42Gmostly conserved

43Gmostly conserved

44Amostly conserved

47Gmostly conserved

48Cmostly conserved

49Tmostly conserved

50Cmostly conserved

51Tmostly conserved

54Gmostly conserved

56Amostly conserved

59Tmostly conserved

61Amostly conserved

62Amostly conserved

63Tmostly conserved

64Tmostly conserved

65Cmostly conserved

66Gmostly conserved

68Amostly conserved

69Cmostly conserved

70Tmostly conserved

71Gmostly conserved

72Amostly conserved

74Tmostly conserved

75Tmostly conserved

77Gmostly conserved

78Gmostly conserved

80Amostly conserved

82Cmostly conserved

83Cmostly conserved

85Amostly conserved

88Tmostly conserved

90Cmostly conserved

92Tmostly conserved

94Amostly conserved

95Amostly conserved

96Tmostly conserved

97Tmostly conserved

99Gmostly conserved

118Tmostly conserved

127Amostly conserved

133Amostly conserved

143Amostly conserved

181Amostly conserved

202Amostly conserved

223Cmostly conserved

235Tmostly conserved

238Cmostly conserved

241Tmostly conserved

256Tmostly conserved

266Cmostly conserved

271Cmostly conserved

274Tmostly conserved

278Cmostly conserved

280Tmostly conserved

283Tmostly conserved

284Cmostly conserved

290Tmostly conserved

292Amostly conserved

302Tmostly conserved

305Gmostly conserved

313Amostly conserved

316Amostly conserved

319Tmostly conserved

328Tmostly conserved

343Cmostly conserved

346Tmostly conserved

352Tmostly conserved

364Amostly conserved

373Amostly conserved

382Amostly conserved

391Tmostly conserved

400Cmostly conserved

401Tmostly conserved

403Amostly conserved

412Tmostly conserved

430Gmostly conserved

433Amostly conserved

439Tmostly conserved

469Tmostly conserved

472Tmostly conserved

475Tmostly conserved

505Tmostly conserved

517Cmostly conserved

526Amostly conserved

532Tmostly conserved

536Tmostly conserved

538Amostly conserved

547Tmostly conserved

556Tmostly conserved

562Amostly conserved

571Tmostly conserved

574Amostly conserved

592Amostly conserved

+31 more variable positions not shown

AACTATATATTTAATCTTTGGAATTTGATCAGCAATAGTAGGGACTGCTCTAAGAATATTAATTCGTACTGAATTAGGAACCCCATCTTC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)3.9%

Haplotypes4

BINs2

Most divergent pair4.9%

EuropeOther

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Ammothea calmanisame genus12.5%Ammothea carolinensissame genus12.9%Ammothea giganteasame genus13.1%Ammothea striatasame genus13.5%Jana eurymassame order17.0%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P18S-3P18S-5P

animal barcoderibosomal

06Genome at a glanceGoaT

The complete instruction manual Ammothea hilgendorfi carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Genome sizehow big the whole instruction manual is

Genome size420 540 000 bp

Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).

BACTERIUM Carsonella ruddii0.00016 Gb

FUNGUS0.04 Gb

INSECT0.25 Gb

THIS GENOME Ammothea hilgendorfi0.42 Gb

HUMAN3.2 Gb

WHEAT17 Gb

FERN Tmesipteris160.45 Gb

08Occurrence & distribution

Record type1 136 records

Wild obs. + sensor606

Museum / vouchered498

Other32

Range

Area of Occupancy AOO992 km²

Depth

0–200 m sunlit84

200–1000 m twilight0

1–4 km midnight1

>4 km abyssal0

median 0.3 m · max 2 750 m · 85 records with depth

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy23% within 1 km

≤100 m 106≤1 km 25≤10 km 426>10 km 1

558 georeferenced · 48 without coordinates

Open the mapobservation + sensor606

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy82% within 1 km

≤100 m 39≤1 km 48≤10 km 16>10 km 3

106 georeferenced · 392 without coordinates

Open the institutions mapphysical evidence498

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions4 of 19 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
National Marine Biodiversity Institute of Korealocation not on record	91
CASlocation not on record	39
CEFASlocation not on record	35
RWSlocation not on record	32
Santa Barbara Museum of Natural Historylocation not on record	18
Los Angeles, US	18
PNHSlocation not on record	6
DASSHlocation not on record	6
South Kensington, GB	5
Natural History Museum Rotterdamlocation not on record	4
Washington, US	4
Sam Noble Oklahoma Museum of Natural Historylocation not on record	3
Marine Biological Association of the UKlocation not on record	2
Cambridge, US	1
DISBLlocation not on record	1
Stanford Universitylocation not on record	1
Natural History Museum, Londonlocation not on record	1
ENHMlocation not on record	1
Akita Prefectural Museumlocation not on record	1

19 institutions · 269 of 498 vouchered records shown

09Environmental DNA19 detections

Where the DNA of Ammothea hilgendorfi was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found19

Studies independent surveys2

Countries4

Verifiable raw sequence linked1

Signal confidence: moderateweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 19 detections have coordinates

Open the map4 countries0

Marina wallfloating dockAmoung seaweed

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median11.8 °C 10.1–17.5

Seasonal swing summer↔winter12.2 °C

Max temp (day)14.5 °C 12.4–20.3

Min temp (night)9.00 °C 7.00–14.5

Precipitation80.8 mm/mo 46.1–99.5

Air humidity63.0 % 59.7–64.8

Moisture balance-19.3 mm/mo -53.3–49.1

Vapour deficit513 Pa 465–763

Wind speed4.10 m/s 3.00–5.00

Cloud cover44.2 % 35.2–48.8

CHELSA 1981–2010, ~9 km grid, at location & month of 12 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Ammothea hilgendorfi

At a glance

Sources8 archives

Habitat & environment2

At a glance

Genome sizehow big the whole instruction manual is

Record type1 136 records

Range

Depth

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions4 of 19 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type1 136 records