Ammothea carolinensis

Leach, 1814 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Pycnogonida/Pantopoda/Ammotheidae/Ammothea

At a glance

Occurrence records821

Data sources7

Biological traits4

DNA specimens24

eDNA detections26

Sources7 archives

Databases and archives Ammothea carolinensis's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility424 records↗

OBISOcean Biodiversity Information System397 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI26 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics24 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

Catalogue of LifeCOLtaxonomy↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources4 traits

Occurrence & distributionGBIF · OBIS821 records

Environmental DNA1 datasets · 1 countries26 detections

DNA & barcodingBOLD24 specimens

01Narrative

Ammothea carolinensis is een zeespin uit de familie Ammotheidae. De soort behoort tot het geslacht Ammothea. Ammothea carolinensis werd in 1814 voor het eerst wetenschappelijk beschreven door Leach.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesSeaLifeBase

Habitat & environment2

Habitat saltwateryes

Habitat zonebenthic

Other traits2

Depth max670 m

Depth min3 m

05DNA & barcoding24 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Ammothea carolinensis has left across the world's sequence archives.

At a glance

DNA specimens24

BINs7

Marker genes11

eDNA detections26

Countries2

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus11 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 88% of positions are identical in every specimen.

Where individuals differ — all 81 variable positions, in barcode order

46Cmostly conserved

70Tmostly conserved

76Tmostly conserved

79Cvariable

85Tmostly conserved

88Avariable

91Tvariable

92Cmostly conserved

97Tmostly conserved

100Amostly conserved

106Tmostly conserved

115Tmostly conserved

133Cvariable

136Tmostly conserved

163Avariable

178Tmostly conserved

184Amostly conserved

187Tmostly conserved

190Amostly conserved

202Tmostly conserved

205Tmostly conserved

220Cvariable

235Cvariable

241Cvariable

250Tmostly conserved

259Tmostly conserved

265Amostly conserved

266Cmostly conserved

268Tvariable

284Tvariable

295Tvariable

298Amostly conserved

316Tmostly conserved

318Cmostly conserved

319Amostly conserved

322Amostly conserved

334Cmostly conserved

335Avariable

340Cvariable

343Tmostly conserved

346Tmostly conserved

361Tmostly conserved

374Tmostly conserved

376Cvariable

379Amostly conserved

385Tmostly conserved

406Tmostly conserved

412Avariable

416Gmostly conserved

418Amostly conserved

421Tmostly conserved

428Tmostly conserved

433Gvariable

454Cmostly conserved

460Tmostly conserved

472Amostly conserved

478Amostly conserved

484Amostly conserved

499Amostly conserved

514Avariable

533Tmostly conserved

542Tmostly conserved

544Amostly conserved

547Cmostly conserved

548Cmostly conserved

556Amostly conserved

562Avariable

583Amostly conserved

592Tmostly conserved

601Tmostly conserved

604Tmostly conserved

607Tmostly conserved

616Tmostly conserved

619Avariable

622Gvariable

625Gvariable

628Avariable

631Amostly conserved

634Tmostly conserved

643Tmostly conserved

646Cmostly conserved

TACTATATATTTAATTTTTGGTATTTGATCAGCAATAGTAGGAACCGCTTTAAGAATATTAATTCGTACTGAACTTGGCACTCCTTCATC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)4.3%

Haplotypes5

BINs6

Most divergent pair6.7%

AntarcticaOther

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Ammothea longispinasame genus3.8%Ammothea calmanisame genus4.3%Ammothea stylirostrissame genus4.3%Ammothea glacialissame genus4.6%Ammothea bicorniculatasame genus5.3%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5PCOIICOXIIICYTBND1ND2ND3ND4ND4LND5-0ND6

animal barcodemitochondrial

Organelle genome

Besides the big genome in the nucleus, cells carry a small, circular loop of DNA inside the cell's energy factories — the mitochondria. It is inherited almost only from the mother and is a leftover from ancient bacteria that moved into the cell. The mitochondrial markers above (ND*, COX, CYTB…) are read from exactly this loop. Outer ring = one strand, inner ring = the other.

▸ Tap any coloured segment — or a gene chip — to see what it is

Mitochondrion

NC_014671 ↗ · 13 protein · 22 tRNA · 2 rRNA

ND2COX1COX2ATP8ATP6COX3ND3ND5ND4ND4LND6CYTBND1l-rRNAs-rRNA

◖ violet arc = the COI-5P barcode — the ~650 bp read used to ID this species

Pick a coloured segment on the ring — or a gene chip — to read what that gene does.

protein-codingrRNAtRNA

08Occurrence & distribution

Record type821 records

Wild obs. + sensor140

Museum / vouchered205

Other476

Range

Area of Occupancy AOO768 km²

Depth

0–200 m sunlit218

200–1000 m twilight177

1–4 km midnight0

>4 km abyssal0

median 152.5 m · max 952 m · 395 records with depth

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy100% within 1 km

≤100 m 72≤1 km 6

78 georeferenced · 62 without coordinates

Open the mapobservation + sensor140

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy97% within 1 km

≤1 km 38>10 km 1

39 georeferenced · 166 without coordinates

Open the institutions mapphysical evidence205

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions4 of 7 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Earth Sciences New Zealandlocation not on record	60
British Antarctic Surveylocation not on record	19
Washington, US	13
P. P. Shirshov Institute of Oceanologylocation not on record	8
Paris, FR	8
Sydney, AU	5
Cambridge, US	1

7 institutions · 114 of 205 vouchered records shown · 1 without an institution code

09Environmental DNA26 detections

Where the DNA of Ammothea carolinensis was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found26

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 26 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median-4.80 °C -17.6–-4.50

Seasonal swing summer↔winter22.2 °C

Max temp (day)-3.50 °C -15.4–-3.00

Min temp (night)-7.50 °C -19.9–-7.10

Precipitation27.4 mm/mo 21.0–30.1

Air humidity48.0 % 46.8–48.3

Vapour deficit226 Pa 98.7–228

Cloud cover56.2 % 53.8–62.7

CHELSA 1981–2010, ~9 km grid, at location & month of 22 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)