Ammophila urnaria

Dahlbom, 1843 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Hymenoptera/Sphecidae/Ammophila

At a glance

Occurrence records372

Data sources6

Biological traits0

DNA specimens16

eDNA detections16

Sources6 archives

Databases and archives Ammophila urnaria's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility372 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI16 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics16 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF372 records

Environmental DNA1 datasets · 2 countries16 detections

DNA & barcodingBOLD16 specimens

01Narrative

Ammophila urnaria là một loài côn trùng cánh màng trong họ Sphecidae, thuộc chi Ammophila. Loài này được Dahlbom miêu tả khoa học đầu tiên năm 1843.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding16 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Ammophila urnaria has left across the world's sequence archives.

At a glance

DNA specimens16

BINs1

Marker genes1

eDNA detections16

Countries2

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus14 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 98% of positions are identical in every specimen.

Where individuals differ — all 16 variable positions, in barcode order

31Avariable

49Amostly conserved

52Amostly conserved

133Amostly conserved

223Amostly conserved

253Avariable

268Cvariable

316Avariable

373Avariable

400Amostly conserved

430Amostly conserved

451Cmostly conserved

514Tvariable

622Amostly conserved

628Avariable

653Tvariable

AATACTCTATTTTATTTTTAGAATATGATCAGGATTATATGGAGCTTCATTAAGAATAATTATTCGACTAGAATTAGGAACTCCCGGAAA …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.78%

Haplotypes4

BIN1

Most divergent pair1.4%

N.America

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Ammophila picipessame genus10.8%Ammophila abertisame genus12.0%Ammophila evansisame genus12.3%Ammophila campestrissame genus12.6%Ammophila macrasame genus12.8%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type372 records

Wild obs. + sensor41

Museum / vouchered331

Range

Area of Occupancy AOO612 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy91% within 1 km

≤100 m 25≤1 km 7>10 km 3

35 georeferenced · 6 without coordinates

Open the mapobservation + sensor41

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy16% within 1 km

≤100 m 5≤1 km 5≤10 km 46>10 km 6

62 georeferenced · 269 without coordinates

Open the institutions mapphysical evidence331

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions9 of 16 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
University of Central Floridalocation not on record	105
University of Guelphlocation not on record	88
US	32
WIlocation not on record	24
New Haven, US	16
College Station, US	13
Champaign, US	9
Universidad Católica de Manizaleslocation not on record	7
University of Guelph, Centre for Biodiversity Genomicslocation not on record	6
Lake Placid, US	6
Toronto, CA	5
OSUClocation not on record	4
Chicago, US	3
Cambridge, US	2
San Diego, US	1
Centre for Biodiversity Genomicslocation not on record	1

16 institutions · 322 of 331 vouchered records shown · 9 without an institution code

09Environmental DNA16 detections

Where the DNA of Ammophila urnaria was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found16

Studies independent surveys1

Countries2

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 16 detections have coordinates

Open the map2 countries0

WetlandForestRiparian Zone

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median18.4 °C 14.9–24.6

Seasonal swing summer↔winter26.4 °C

Max temp (day)21.0 °C 19.5–29.6

Min temp (night)16.5 °C 11.9–20.5

Precipitation91.0 mm/mo 88.5–130

Air humidity59.7 % 58.0–61.6

Moisture balance-53.5 mm/mo -65.4–10.0

Vapour deficit833 Pa 662–1,299

Wind speed4.40 m/s 2.20–5.00

Cloud cover42.3 % 33.8–51.4

CHELSA 1981–2010, ~9 km grid, at location & month of 15 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)