Ammophila pubescens

Curtis, 1836 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Hymenoptera/Sphecidae/Ammophila

At a glance

Occurrence records5 094

Data sources9

Biological traits2

DNA specimens20

eDNA detections22

Sources9 archives

Databases and archives Ammophila pubescens's data was compiled from.

WikipediaWikimedia Foundation4 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility5 094 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI22 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics20 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GoaTGenomes on a Tree · Sangergenome & karyotype↗

NCBIUS National Library of Medicinegenome & karyotype↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources2 traits

Occurrence & distributionGBIF5 094 records

Environmental DNA3 datasets · 6 countries22 detections

DNA & barcodingBOLD20 specimens

Genome at a glanceGoaT · NCBI≈529 Mbp

01Narrative

Die Dreiphasen-Sandwespe (Ammophila pubescens) ist ein Hautflügler aus der Familie der Sphecidae.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesPantheon

Diet & foraging2

Feeding guild (adult)nectivore

Feeding guild (larval)parasitoid

05DNA & barcoding20 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Ammophila pubescens has left across the world's sequence archives.

At a glance

DNA specimens20

BINs2

Marker genes1

eDNA detections22

Countries6

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus15 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 88% of positions are identical in every specimen.

Where individuals differ — all 78 variable positions, in barcode order

10Cmostly conserved

16Cmostly conserved

22Amostly conserved

34Amostly conserved

40Tmostly conserved

49Tmostly conserved

50Tmostly conserved

55Tmostly conserved

64Tmostly conserved

67Tmostly conserved

74Cmostly conserved

76Cmostly conserved

79Amostly conserved

82Tmostly conserved

115Tmostly conserved

125Gmostly conserved

139Amostly conserved

187Cmostly conserved

212Tmostly conserved

223Cmostly conserved

232Tmostly conserved

235Cmostly conserved

271Cmostly conserved

277Amostly conserved

295Tmostly conserved

303Cmostly conserved

307Amostly conserved

316Amostly conserved

322Tmostly conserved

325Amostly conserved

328Amostly conserved

337Amostly conserved

346Cmostly conserved

347Tmostly conserved

352Amostly conserved

359Cmostly conserved

364Cmostly conserved

369Gmostly conserved

370Amostly conserved

382Tmostly conserved

394Tmostly conserved

400Cmostly conserved

403Tmostly conserved

407Cmostly conserved

409Gmostly conserved

412Amostly conserved

416Amostly conserved

417Tmostly conserved

424Gmostly conserved

430Amostly conserved

439Tmostly conserved

458Amostly conserved

460Amostly conserved

479Cmostly conserved

484Amostly conserved

502Amostly conserved

514Tmostly conserved

517Tmostly conserved

526Amostly conserved

533Cmostly conserved

535Tmostly conserved

538Amostly conserved

542Cmostly conserved

548Cmostly conserved

550Tmostly conserved

556Amostly conserved

557Cmostly conserved

562Amostly conserved

565Cmostly conserved

586Tmostly conserved

592Tmostly conserved

598Cmostly conserved

610Tmostly conserved

616Cmostly conserved

622Tmostly conserved

625Gmostly conserved

637Amostly conserved

658Tmostly conserved

AATACTTTACTTTATCTTTAGAATATGAGCAGGAATATATGGAGCTTCTTTAAGTATAATTATTCGTATAGAACTCGGAACTCCAGGAAA …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)3.8%

Haplotypes3

BINs2

Most divergent pair10.6%

Europe

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Ammophila campestrissame genus10.3%Ammophila terminatasame genus10.6%Ammophila sabulosasame genus12.8%Ammophila aztecasame genus13.2%Ammophila macrasame genus13.4%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

06Genome at a glanceGoaT · NCBI

The complete instruction manual Ammophila pubescens carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Genome sizehow big the whole instruction manual is

Genome size≈528 531 114 bp assembly estimate

Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).

BACTERIUM Carsonella ruddii0.00016 Gb

FUNGUS0.04 Gb

INSECT0.25 Gb

THIS GENOME Ammophila pubescens0.53 Gb

HUMAN3.2 Gb

WHEAT17 Gb

FERN Tmesipteris160.45 Gb

Sequencing statusassembly quality — how far to trust these numbers

Assembly level tells you how finished the sequence is — from fragmented contigs, through scaffolds, up to a full chromosome-level assembly. BUSCO % estimates completeness: the share of genes expected to be present that were actually found. These describe the data quality, not the organism.

Assembly levelChromosome

Completeness93.8% BUSCO

08Occurrence & distribution

Record type5 094 records

Wild obs. + sensor2 609

Museum / vouchered2 481

Other4

Range

Area of Occupancy AOO6 604 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy80% within 1 km

≤100 m 1 457≤1 km 483≤10 km 475

2 415 georeferenced · 194 without coordinates

Open the mapobservation + sensor2 609

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy65% within 1 km

≤100 m 1 056≤1 km 360≤10 km 752>10 km 8

2 176 georeferenced · 305 without coordinates

Open the institutions mapphysical evidence2 481

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions15 of 29 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
SLU Artdatabankenlocation not on record	850
Helsinki, FI	781
Philadelphia, US	258
Zürich, CH	60
Provincia di Livornolocation not on record	51
Metsähallituslocation not on record	47
Tilburg, NL	37
NMOKlocation not on record	36
Trondheim, NO	34
Natural History Museum Rotterdamlocation not on record	33
Tartu, EE	26
NHMOlocation not on record	14
Muzeum Górnośląskie w Bytomiulocation not on record	12
Adam Mickiewicz University in Poznańlocation not on record	12
NCMGlocation not on record	10
Champaign, US	10
ZSMlocation not on record	8
Kuopio, FI	7
ZMAAlocation not on record	7
Stockholm, SE	6
BioFokuslocation not on record	6
South Kensington, GB	6
Bonn, DE	5
Bavarian State Collection of Zoologylocation not on record	4
neflocation not on record	4
US	2
Rovaniemi, FI	2
Tallinn, EE	1
Gothenburg, SE	1

29 institutions · 2 330 of 2 481 vouchered records shown · 151 without an institution code

09Environmental DNA22 detections

Where the DNA of Ammophila pubescens was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found22

Studies independent surveys3

Countries6

Verifiable raw sequence linked5

Signal confidence: moderateweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 22 detections have coordinates

Open the map6 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median16.8 °C 14.7–21.2

Seasonal swing summer↔winter19.0 °C

Max temp (day)21.2 °C 18.7–25.4

Min temp (night)12.2 °C 10.5–14.6

Precipitation73.6 mm/mo 53.4–95.3

Air humidity58.3 % 53.8–59.6

Moisture balance-46.7 mm/mo -83.1–-13.9

Vapour deficit805 Pa 674–1,167

Wind speed2.70 m/s 2.20–3.80

Cloud cover36.1 % 27.3–49.0

CHELSA 1981–2010, ~9 km grid, at location & month of 21 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Ammophila pubescens

At a glance

Sources9 archives

Diet & foraging2

At a glance

Genome sizehow big the whole instruction manual is

Sequencing statusassembly quality — how far to trust these numbers

Record type5 094 records

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions15 of 29 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type5 094 records