Amerila bauri

Möschler, 1884 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Erebidae/Amerila

At a glance

Occurrence records150

Data sources7

Biological traits0

DNA specimens5

eDNA detections7

Sources7 archives

Databases and archives Amerila bauri's data was compiled from.

WikipediaWikimedia Foundation4 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility150 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI7 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics5 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF150 records

Environmental DNA1 datasets · 1 countries7 detections

DNA & barcodingBOLD5 specimens

01Narrative

Amerila bauri Amerila bauri is a moth of the subfamily Arctiinae. It was described by Heinrich Benno Möschler in 1884. It is found in Mozambique, Namibia, South Africa and Zimbabwe. The larvae feed on Eugenia species and Syzygium cordatum.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding5 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Amerila bauri has left across the world's sequence archives.

At a glance

DNA specimens5

BINs2

Marker genes1

eDNA detections7

Countries2

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus5 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 95% of positions are identical in every specimen.

Where individuals differ — all 34 variable positions, in barcode order

5Cmostly conserved

31Tmostly conserved

34Amostly conserved

99Gmostly conserved

112Tmostly conserved

115Tmostly conserved

133Tmostly conserved

157Cmostly conserved

202Amostly conserved

205Cmostly conserved

217Gmostly conserved

232Amostly conserved

271Cmostly conserved

304Cmostly conserved

322Amostly conserved

334Tmostly conserved

367Cmostly conserved

370Tmostly conserved

400Amostly conserved

403Tmostly conserved

412Gmostly conserved

475Cmostly conserved

484Tmostly conserved

499Amostly conserved

508Gmostly conserved

532Cmostly conserved

562Cmostly conserved

604Cmostly conserved

607Cmostly conserved

613Cmostly conserved

619Amostly conserved

625Tmostly conserved

637Gmostly conserved

640Tmostly conserved

AACACTATATTTTATTTTTGGTATTTGAGCTGGAATAGTTGGAACATCTTTAAGATTATTAATTCGAGCTGAATTAGGAAATCCAGGATC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)2.1%

Haplotypes3

BINs2

Most divergent pair0.30%

Africa

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Amerila vitreasame genus3.7%Amerila astreussame genus3.8%Amerila omissasame genus4.3%Amerila albertisame genus4.4%Amerila timolissame genus4.6%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type150 records

Wild obs. + sensor146

Museum / vouchered4

Range

Area of Occupancy AOO324 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy94% within 1 km

≤100 m 54≤1 km 9≤10 km 2>10 km 2

67 georeferenced · 79 without coordinates

Open the mapobservation + sensor146

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy0% within 1 km

≤10 km 1

1 georeferenced · 3 without coordinates

Open the institutions mapphysical evidence4

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions1 of 1 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
New Haven, US	1

1 institutions · 1 of 4 vouchered records shown · 3 without an institution code

09Environmental DNA7 detections

Where the DNA of Amerila bauri was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found7

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 7 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median17.4 °C 14.6–24.6

Seasonal swing summer↔winter6.60 °C

Max temp (day)22.2 °C 19.1–28.0

Min temp (night)12.3 °C 10.2–21.3

Precipitation39.5 mm/mo 8.70–215

Air humidity61.5 % 57.5–62.9

Moisture balance-67.6 mm/mo

Vapour deficit808 Pa 635–1,217

Wind speed2.50 m/s

Cloud cover16.7 % 13.3–29.9

CHELSA 1981–2010, ~9 km grid, at location & month of 6 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)