Amerila astreus

(Drury, 1773) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Erebidae/Amerila

At a glance

Occurrence records744

Data sources6

Biological traits0

DNA specimens28

eDNA detections11

Sources6 archives

Databases and archives Amerila astreus's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility744 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI11 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics28 specimens↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF744 records

Environmental DNA1 datasets · 4 countries11 detections

DNA & barcodingBOLD28 specimens

01Narrative

Amerila astreus is a moth of subfamily Arctiinae described by Dru Drury in 1773. It is found from the Oriental region (including India, Sri Lanka) to New Guinea. The species is found in primary and secondary habitats ranging from lowlands to montane regions.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding28 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Amerila astreus has left across the world's sequence archives.

At a glance

DNA specimens28

BINs5

Marker genes2

eDNA detections11

Countries5

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus19 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 93% of positions are identical in every specimen.

Where individuals differ — all 46 variable positions, in barcode order

5Tmostly conserved

115Tvariable

118Tmostly conserved

133Amostly conserved

157Cvariable

160Gmostly conserved

187Tmostly conserved

202Cmostly conserved

220Cmostly conserved

223Cmostly conserved

232Cmostly conserved

235Tmostly conserved

256Tvariable

265Tmostly conserved

283Tvariable

284Tvariable

304Cvariable

358Tmostly conserved

364Tmostly conserved

400Tmostly conserved

401Tmostly conserved

403Amostly conserved

409Amostly conserved

412Amostly conserved

439Tmostly conserved

475Cvariable

479Tmostly conserved

484Amostly conserved

508Avariable

514Tmostly conserved

532Tmostly conserved

541Tmostly conserved

557Tvariable

574Tmostly conserved

578Cvariable

580Amostly conserved

589Cmostly conserved

595Cvariable

604Tmostly conserved

616Tmostly conserved

619Tmostly conserved

622Tmostly conserved

631Avariable

640Tmostly conserved

646Tmostly conserved

653Tmostly conserved

AACATTATATTTTATTTTTGGTATTTGAGCTGGAATAGTTGGAACATCTTTAAGATTATTAATTCGAGCTGAATTAGGAAATCCAGGATC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)2.7%

Haplotypes10

BINs5

Most divergent pair5.8%

AsiaOther

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Amerila crokerisame genus1.7%Amerila timolissame genus1.7%Amerila rubripessame genus1.8%Amerila sericasame genus2.7%Amerila nigropunctatasame genus3.5%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-3P★COI-5P

animal barcode

08Occurrence & distribution

Record type744 records

Wild obs. + sensor541

Museum / vouchered203

Range

Area of Occupancy AOO1 444 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy79% within 1 km

≤100 m 91≤1 km 59≤10 km 22>10 km 19

191 georeferenced · 350 without coordinates

Open the mapobservation + sensor541

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy33% within 1 km

≤1 km 1≤10 km 2

3 georeferenced · 200 without coordinates

Open the institutions mapphysical evidence203

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions2 of 10 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
tesrilocation not on record	91
FACTlocation not on record	80
Helsinki, FI	8
Royal British Columbia Museumlocation not on record	5
ZSMlocation not on record	2
RMBHlocation not on record	2
Bavarian State Collection of Zoologylocation not on record	2
Denver, US	1
Natural History Museum Rotterdamlocation not on record	1
MZLUlocation not on record	1

10 institutions · 193 of 203 vouchered records shown · 10 without an institution code

09Environmental DNA11 detections

Where the DNA of Amerila astreus was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found11

Studies independent surveys1

Countries4

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 11 detections have coordinates

Open the map4 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median25.5 °C 24.7–31.0

Seasonal swing summer↔winter5.10 °C

Max temp (day)29.3 °C 26.5–35.7

Min temp (night)22.2 °C 21.0–26.2

Precipitation233 mm/mo 69.5–511

Air humidity68.3 % 56.5–69.6

Moisture balance92.2 mm/mo -117–350

Vapour deficit1,025 Pa 960–1,899

Wind speed2.20 m/s 0.6–4.40

Cloud cover56.2 % 31.5–66.3

CHELSA 1981–2010, ~9 km grid, at location & month of 10 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)