Americorchestia megalophthalma

(Spence Bate, 1862) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Malacostraca/Amphipoda/Talitridae/Americorchestia

At a glance

Occurrence records139

Data sources7

Biological traits1

DNA specimens18

eDNA detections16

Sources7 archives

Databases and archives Americorchestia megalophthalma's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility122 records↗

OBISOcean Biodiversity Information System17 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI16 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics18 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources1 traits

Occurrence & distributionGBIF · OBIS139 records

Environmental DNA1 datasets · 1 countries16 detections

DNA & barcodingBOLD18 specimens

01Narrative

Americorchestia megalophthalma, the northern big-eyed sandhopper, is a species of beach hopper in the family Talitridae.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesSeaLifeBase

Habitat & environment1

Habitat saltwateryes

05DNA & barcoding18 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Americorchestia megalophthalma has left across the world's sequence archives.

At a glance

DNA specimens18

BINs1

Marker genes2

eDNA detections16

Countries1

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus16 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 100% of positions are identical in every specimen.

Where individuals differ — all 3 variable positions, in barcode order

10Cmostly conserved

481Gmostly conserved

565Amostly conserved

TACATTATACTTCATACTTGGAGGATGAGCTAGAATGGTTGGAACTTCTCTTAGACTCCTAATCCGCTCAGAACTAAGTGCCCCTGGAAA …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.07%

Haplotypes4

BIN1

Most divergent pair0.30%

N.America

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Americorchestia longicornissame genus17.0%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P18S

animal barcoderibosomal

08Occurrence & distribution

Record type139 records

Wild obs. + sensor48

Museum / vouchered91

Range

Area of Occupancy AOO368 km²

Depth

0–200 m sunlit6

200–1000 m twilight0

1–4 km midnight0

>4 km abyssal0

median 0 m · max 27.4 m · 6 records with depth

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy73% within 1 km

≤100 m 18≤1 km 4≤10 km 4>10 km 4

30 georeferenced · 18 without coordinates

Open the mapobservation + sensor48

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy7% within 1 km

≤1 km 2≤10 km 25>10 km 2

29 georeferenced · 62 without coordinates

Open the institutions mapphysical evidence91

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions2 of 4 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Museo civico La Terra e l'Uomo di Crocetta del Montellolocation not on record	53
Cambridge, US	28
New Haven, US	2
The Atlantic reference Centrelocation not on record	2

4 institutions · 85 of 91 vouchered records shown · 4 without an institution code

09Environmental DNA16 detections

Where the DNA of Americorchestia megalophthalma was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found16

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 16 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median18.2 °C 16.9–18.2

Seasonal swing summer↔winter22.3 °C

Max temp (day)20.4 °C 18.4–20.8

Min temp (night)16.6 °C 15.5–16.8

Precipitation112 mm/mo 89.7–112

Air humidity66.5 % 62.9–68.2

Moisture balance-18.9 mm/mo

Vapour deficit700 Pa 624–770

Wind speed4.80 m/s

Cloud cover42.6 % 42.6–50.8

CHELSA 1981–2010, ~9 km grid, at location & month of 16 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)