Americorchestia longicornis

(Say, 1818) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Malacostraca/Amphipoda/Talitridae/Americorchestia

At a glance

Occurrence records194

Data sources8

Biological traits1

DNA specimens17

eDNA detections16

Sources8 archives

Databases and archives Americorchestia longicornis's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility176 records↗

OBISOcean Biodiversity Information System18 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI16 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics17 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

Catalogue of LifeCOLtaxonomy↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources1 traits

Occurrence & distributionGBIF · OBIS194 records

Environmental DNA1 datasets · 1 countries16 detections

DNA & barcodingBOLD17 specimens

01Narrative

Americorchestia longicornis, the common Atlantic sandhopper, is a species of beach hopper in the family Talitridae.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesSeaLifeBase

Habitat & environment1

Habitat saltwateryes

05DNA & barcoding17 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Americorchestia longicornis has left across the world's sequence archives.

At a glance

DNA specimens17

BINs1

Marker genes2

eDNA detections16

Countries1

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus16 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 100% of positions are identical in every specimen.

Where individuals differ — all 3 variable positions, in barcode order

74Cmostly conserved

100Amostly conserved

271Tmostly conserved

TACCCTGTACTTCATGCTTGGAAGATGAGCTAGTATAACTGGCACCTCTCTAAGACTACTAATCCGGTCAGAACTAAGAGCCCCTGGAAA …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.06%

Haplotypes3

BIN1

Most divergent pair0.46%

N.America

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Americorchestia megalophthalmasame genus17.0%Americorchestia heardisame genus17.3%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P18S

animal barcoderibosomal

08Occurrence & distribution

Record type194 records

Wild obs. + sensor48

Museum / vouchered144

Other2

Range

Area of Occupancy AOO456 km²

Depth

0–200 m sunlit5

200–1000 m twilight0

1–4 km midnight0

>4 km abyssal0

median 1 m · max 2 m · 5 records with depth

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy93% within 1 km

≤100 m 25≤1 km 3>10 km 2

30 georeferenced · 18 without coordinates

Open the mapobservation + sensor48

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy0% within 1 km

≤10 km 45>10 km 15

60 georeferenced · 84 without coordinates

Open the institutions mapphysical evidence144

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions3 of 6 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Museo civico La Terra e l'Uomo di Crocetta del Montellolocation not on record	70
Cambridge, US	51
New Haven, US	5
University of Guelph, Centre for Biodiversity Genomicslocation not on record	1
RBINS-Scientific Heritagelocation not on record	1
Brussels, BE	1

6 institutions · 129 of 144 vouchered records shown · 11 without an institution code

09Environmental DNA16 detections

Where the DNA of Americorchestia longicornis was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found16

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 16 detections have coordinates

Open the map1 country0

Beach

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median18.8 °C 17.4–19.1

Seasonal swing summer↔winter24.8 °C

Max temp (day)22.2 °C 18.4–22.2

Min temp (night)16.8 °C 15.8–17.1

Precipitation112 mm/mo 89.6–118

Air humidity62.4 % 61.9–66.9

Moisture balance-29.2 mm/mo

Vapour deficit820 Pa 674–842

Wind speed4.50 m/s

Cloud cover44.8 % 42.5–50.4

CHELSA 1981–2010, ~9 km grid, at location & month of 16 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)