Amegilla spilostoma

(Cameron, 1905) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Hymenoptera/Apidae/Amegilla

At a glance

Occurrence records494

Data sources7

Biological traits2

DNA specimens8

eDNA detections1

Sources7 archives

Databases and archives Amegilla spilostoma's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility494 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI1 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics8 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources2 traits

Occurrence & distributionGBIF494 records

Environmental DNA1 datasets · 1 countries1 detections

DNA & barcodingBOLD8 specimens

01Narrative

Amegilla spilostoma es una especie de abeja del género Amegilla, familia Apidae.Amegilla TSN 634005 Sistema Integrado de Información Taxonómica. Consultado el 2 de mayo de 2021.Amegilla Catalogue of Life. Consultado el 2 de mayo de 2021. Fue descrita científicamente por Cameron en 1905.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesBeeMorph

Size & morphology2

Intertegular distance (ITD)2.59 mm

Tongue length5.33 mm

05DNA & barcoding8 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Amegilla spilostoma has left across the world's sequence archives.

At a glance

DNA specimens8

BINs1

Marker genes1

eDNA detections1

Countries1

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus6 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 99% of positions are identical in every specimen.

Where individuals differ — all 6 variable positions, in barcode order

112Cmostly conserved

206Tvariable

400Cvariable

559Gmostly conserved

568Cvariable

641Cmostly conserved

TATAAATTATTTTATTTTTGCTATGTGGTCAGGTATAGTAGGATCTTCTATGAGTTTAATTATTCGTATAGAGTTAAGAGTACCTGGTGC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.42%

Haplotypes5

BIN1

Most divergent pair0.76%

Africa

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Anthophora praecoxsame family11.7%Amegilla obscuricepssame genus13.1%Amegilla thorogoodisame genus14.0%Amegilla walkerisame genus14.1%Amegilla pulchrasame genus14.6%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type494 records

Wild obs. + sensor17

Museum / vouchered477

Range

Area of Occupancy AOO976 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy88% within 1 km

≤100 m 13≤1 km 1≤10 km 1>10 km 1

16 georeferenced · 1 without coordinates

Open the mapobservation + sensor17

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy0% within 1 km

≤10 km 3>10 km 1

4 georeferenced · 473 without coordinates

Open the institutions mapphysical evidence477

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions5 of 9 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Sydney, AU	231
Cape Town, ZA	80
ARC-Plant Protection Research Institute, National Collection of Fungi: Culture Collectionlocation not on record	73
Atlantic Reference Centrelocation not on record	56
Durban Natural Science Museumlocation not on record	16
Wuzhou, CN	9
Beltsville, US	8
Cambridge, US	2
Agricultural Research Council, South Africalocation not on record	2

9 institutions · 477 of 477 vouchered records shown

09Environmental DNA1 detections

Where the DNA of Amegilla spilostoma was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found1

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 1 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median24.7 °C 24.7–24.7

Seasonal swing summer↔winter15.6 °C

Max temp (day)31.6 °C

Min temp (night)18.2 °C

Precipitation65.7 mm/mo

Air humidity50.4 %

Moisture balance-99.8 mm/mo

Vapour deficit1,553 Pa

Wind speed2.70 m/s

Cloud cover26.4 %

CHELSA 1981–2010, ~9 km grid, at location & month of 1 detection point · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)